Incidental Mutation 'R6536:Wac'
ID543529
Institutional Source Beutler Lab
Gene Symbol Wac
Ensembl Gene ENSMUSG00000024283
Gene NameWW domain containing adaptor with coiled-coil
Synonyms1110067P07Rik, A230035H12Rik, Wwp4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6536 (G1)
Quality Score58.0073
Status Validated
Chromosome18
Chromosomal Location7868832-7973547 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 7905189 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074919] [ENSMUST00000092112] [ENSMUST00000166062] [ENSMUST00000167020] [ENSMUST00000168446] [ENSMUST00000169010] [ENSMUST00000171042] [ENSMUST00000171486] [ENSMUST00000172018]
Predicted Effect probably null
Transcript: ENSMUST00000074919
SMART Domains Protein: ENSMUSP00000074454
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 287 307 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092112
SMART Domains Protein: ENSMUSP00000089746
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 100 122 N/A INTRINSIC
WW 130 162 2.12e-7 SMART
low complexity region 229 249 N/A INTRINSIC
low complexity region 262 273 N/A INTRINSIC
low complexity region 408 423 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165854
SMART Domains Protein: ENSMUSP00000126815
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 20 42 N/A INTRINSIC
WW 50 82 2.12e-7 SMART
low complexity region 265 280 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166062
SMART Domains Protein: ENSMUSP00000132532
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 287 307 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167020
SMART Domains Protein: ENSMUSP00000132117
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 100 122 N/A INTRINSIC
WW 130 162 2.12e-7 SMART
low complexity region 252 267 N/A INTRINSIC
low complexity region 332 352 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 511 526 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168446
SMART Domains Protein: ENSMUSP00000131032
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 106 128 N/A INTRINSIC
WW 136 168 2.12e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169010
SMART Domains Protein: ENSMUSP00000131750
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
Pfam:WW 86 113 2.8e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171042
SMART Domains Protein: ENSMUSP00000133185
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 184 204 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
low complexity region 359 374 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171486
SMART Domains Protein: ENSMUSP00000127848
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 184 204 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
low complexity region 360 375 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172018
SMART Domains Protein: ENSMUSP00000128321
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 287 307 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a WW domain, which is a protein module found in a wide range of signaling proteins. This domain mediates protein-protein interactions and binds proteins containing short linear peptide motifs that are proline-rich or contain at least one proline. This gene product shares 94% sequence identity with the WAC protein in mouse, however, its exact function is not known. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 49,019,723 H628N probably benign Het
Abcb1a T A 5: 8,719,030 F751I probably benign Het
Adamts13 G A 2: 26,975,750 V106M probably damaging Het
Add1 C A 5: 34,601,436 N31K possibly damaging Het
Adgrf5 G T 17: 43,422,661 probably benign Het
Akap11 T G 14: 78,511,314 D1211A possibly damaging Het
Atp5c1 G A 2: 10,080,316 probably benign Het
Cd320 T C 17: 33,847,503 S72P probably benign Het
Clca4b C A 3: 144,916,729 W525L possibly damaging Het
Csmd3 G A 15: 47,838,467 T1740I probably damaging Het
Dnah7c T G 1: 46,658,290 S2122A probably benign Het
Enpp2 T C 15: 54,862,631 N583S probably damaging Het
Fuk A G 8: 110,883,879 V964A possibly damaging Het
Gpd2 A T 2: 57,345,355 I366F probably benign Het
Hsd17b2 G A 8: 117,702,182 V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi44 A G 3: 151,732,489 V387A probably benign Het
Kcnc4 T C 3: 107,448,196 D312G possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klra6 C T 6: 130,023,719 V41I probably benign Het
Lrp1 A G 10: 127,558,068 probably null Het
Mpdz T C 4: 81,383,417 E257G probably damaging Het
Olfr1306 T C 2: 111,912,774 D52G possibly damaging Het
Olfr1420 T C 19: 11,896,396 V125A probably benign Het
Papln A G 12: 83,781,887 Y789C probably damaging Het
Pcdh15 T C 10: 74,631,389 L1680P probably damaging Het
Pcdhac1 A G 18: 37,090,314 N60S probably benign Het
Polr3g T C 13: 81,678,216 N162S unknown Het
Pou3f3 A G 1: 42,698,214 I357V probably damaging Het
Sycp2 A G 2: 178,351,648 S1235P probably damaging Het
Tdgf1 A T 9: 110,944,189 probably null Het
Tns3 A T 11: 8,434,531 V1429E probably damaging Het
Trim67 T C 8: 124,794,342 S148P possibly damaging Het
Usp49 A T 17: 47,679,692 I348F probably damaging Het
Zfp775 A G 6: 48,619,609 K139R probably damaging Het
Other mutations in Wac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02404:Wac APN 18 7917570 missense probably damaging 1.00
BB007:Wac UTSW 18 7921560 missense possibly damaging 0.47
BB017:Wac UTSW 18 7921560 missense possibly damaging 0.47
R1077:Wac UTSW 18 7921916 missense probably damaging 1.00
R2915:Wac UTSW 18 7926131 missense possibly damaging 0.96
R3196:Wac UTSW 18 7917568 missense probably damaging 1.00
R3793:Wac UTSW 18 7920190 missense possibly damaging 0.86
R3840:Wac UTSW 18 7918535 missense probably damaging 1.00
R3971:Wac UTSW 18 7916175 missense probably damaging 1.00
R6402:Wac UTSW 18 7901585 missense possibly damaging 0.71
R6429:Wac UTSW 18 7920163 missense probably damaging 0.97
R6615:Wac UTSW 18 7868884 splice site probably null
R6645:Wac UTSW 18 7973523 missense probably damaging 1.00
R7088:Wac UTSW 18 7921455 missense probably damaging 0.99
R7464:Wac UTSW 18 7871746 critical splice donor site probably null
R7760:Wac UTSW 18 7921913 missense probably benign 0.43
R7930:Wac UTSW 18 7921560 missense possibly damaging 0.47
R8515:Wac UTSW 18 7871606 missense probably benign 0.01
X0066:Wac UTSW 18 7916298 critical splice donor site probably null
Z1176:Wac UTSW 18 7973531 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATAGGGTTGTTTAAACAGGTC -3'
(R):5'- TGCTCAGACCAATCATCTGCAG -3'

Sequencing Primer
(F):5'- TTAACCTGCCTTTCTTGTCTTAGAC -3'
(R):5'- AATCATCTGCAGAATCATAAGGC -3'
Posted On2019-02-18