Incidental Mutation 'R6668:Aanat'
ID543531
Institutional Source Beutler Lab
Gene Symbol Aanat
Ensembl Gene ENSMUSG00000020804
Gene Namearylalkylamine N-acetyltransferase
SynonymsNat-2, SNAT, Nat4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6668 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116586432-116597680 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 116596042 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021160] [ENSMUST00000103028] [ENSMUST00000103029] [ENSMUST00000123507] [ENSMUST00000153476]
Predicted Effect probably benign
Transcript: ENSMUST00000021160
SMART Domains Protein: ENSMUSP00000021160
Gene: ENSMUSG00000020804

DomainStartEndE-ValueType
PDB:1KUY|A 3 104 1e-50 PDB
SCOP:d1cjwa_ 28 103 4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103028
SMART Domains Protein: ENSMUSP00000099317
Gene: ENSMUSG00000020806

DomainStartEndE-ValueType
Pfam:Rhomboid_SP 98 306 1.8e-98 PFAM
transmembrane domain 376 398 N/A INTRINSIC
Pfam:Rhomboid 619 763 4.6e-31 PFAM
transmembrane domain 775 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103029
SMART Domains Protein: ENSMUSP00000099318
Gene: ENSMUSG00000020806

DomainStartEndE-ValueType
Pfam:Rhomboid_SP 98 304 4.7e-97 PFAM
transmembrane domain 376 398 N/A INTRINSIC
Pfam:Rhomboid 619 763 8.1e-31 PFAM
transmembrane domain 775 797 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000123507
AA Change: A55S
SMART Domains Protein: ENSMUSP00000115999
Gene: ENSMUSG00000020804
AA Change: A55S

DomainStartEndE-ValueType
PDB:1IB1|H 3 53 6e-16 PDB
SCOP:d1cjwa_ 28 59 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153476
SMART Domains Protein: ENSMUSP00000122895
Gene: ENSMUSG00000020804

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 82 172 4.1e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the acetyltransferase superfamily. It is the penultimate enzyme in melatonin synthesis and controls the night/day rhythm in melatonin production in the vertebrate pineal gland. Melatonin is essential for the function of the circadian clock that influences activity and sleep. This enzyme is regulated by cAMP-dependent phosphorylation that promotes its interaction with 14-3-3 proteins and thus protects the enzyme against proteasomal degradation. This gene may contribute to numerous genetic diseases such as delayed sleep phase syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mutations in this gene result in abnormal melatonin production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b A T 8: 43,520,690 V425D possibly damaging Het
Ahctf1 A G 1: 179,752,407 S2077P probably benign Het
Amacr A G 15: 10,983,382 T93A probably benign Het
Arsb T A 13: 93,794,220 probably null Het
Bcas3 G A 11: 85,801,851 R354Q probably damaging Het
Chia1 C T 3: 106,130,948 L387F probably damaging Het
Cyp24a1 A T 2: 170,485,885 probably null Het
Dennd4a G A 9: 64,886,965 G689S probably damaging Het
Elovl4 G A 9: 83,805,986 A18V probably benign Het
Fam135a A T 1: 24,028,848 V80E probably damaging Het
Fmo2 T A 1: 162,877,048 T430S probably benign Het
Fpgs T C 2: 32,687,606 I213V probably benign Het
Gm10134 A T 2: 28,506,251 R53* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ift172 T C 5: 31,255,339 N1524S probably benign Het
Kif1b G A 4: 149,213,407 S1104F probably benign Het
Map3k21 T C 8: 125,926,113 V326A possibly damaging Het
Mlst8 A G 17: 24,477,479 probably null Het
Muc16 A T 9: 18,640,385 S4871T probably benign Het
Myo1d A G 11: 80,583,875 probably benign Het
Ndufa3 A G 7: 3,619,466 Y41C probably damaging Het
Nfkbid T A 7: 30,424,441 L142Q probably benign Het
Olfr885 T A 9: 38,061,770 M150K possibly damaging Het
Peg10 T A 6: 4,754,502 D94E probably benign Het
Phactr3 A T 2: 178,332,864 I492F probably damaging Het
Plxna2 T C 1: 194,810,088 V1751A possibly damaging Het
Prss16 T C 13: 22,006,748 E238G probably null Het
Rad51ap2 T C 12: 11,457,646 V523A probably benign Het
Rbm33 T A 5: 28,342,500 S223T probably benign Het
Ryk T A 9: 102,869,276 F137I possibly damaging Het
Sars2 G A 7: 28,747,004 E194K probably benign Het
Spata2l T C 8: 123,233,428 D374G probably damaging Het
Tenm2 A G 11: 36,046,765 probably null Het
Ubr4 A G 4: 139,465,341 K1097E probably damaging Het
Ulk4 A T 9: 121,188,342 V690E probably damaging Het
Usp34 A G 11: 23,460,659 N2703S probably damaging Het
Zfp273 C G 13: 67,825,124 L124V probably damaging Het
Zfp608 A G 18: 54,898,019 S950P probably damaging Het
Zfp994 A T 17: 22,201,100 H289Q probably damaging Het
Other mutations in Aanat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Aanat APN 11 116595688 missense possibly damaging 0.94
IGL02257:Aanat APN 11 116595709 nonsense probably null
IGL02649:Aanat APN 11 116595646 missense probably benign 0.38
R0894:Aanat UTSW 11 116596904 missense probably benign 0.41
R3771:Aanat UTSW 11 116596871 missense probably damaging 1.00
R3792:Aanat UTSW 11 116596231 missense probably damaging 1.00
R3864:Aanat UTSW 11 116596816 missense probably damaging 1.00
R4468:Aanat UTSW 11 116596955 missense possibly damaging 0.47
R5585:Aanat UTSW 11 116596973 missense probably damaging 1.00
R6013:Aanat UTSW 11 116596124 critical splice acceptor site probably null
R7424:Aanat UTSW 11 116595629 start gained probably benign
X0020:Aanat UTSW 11 116596798 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CTTTGGGAGGCAAATTTGAGAG -3'
(R):5'- AGCCAATGATGAAGGCCAC -3'

Sequencing Primer
(F):5'- TGGGAGGCAAATTTGAGAGCTCTC -3'
(R):5'- TTCCTCAAACCAGCCCAGTG -3'
Posted On2019-02-18