Incidental Mutation 'R6614:Trmt1'
ID543539
Institutional Source Beutler Lab
Gene Symbol Trmt1
Ensembl Gene ENSMUSG00000001909
Gene NametRNA methyltransferase 1
SynonymsD8Ertd812e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R6614 (G1)
Quality Score43.0073
Status Validated
Chromosome8
Chromosomal Location84686307-84699808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 84689333 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 7 (V7L)
Ref Sequence ENSEMBL: ENSMUSP00000135327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001974] [ENSMUST00000109767] [ENSMUST00000109768] [ENSMUST00000131700] [ENSMUST00000143427] [ENSMUST00000152301] [ENSMUST00000177084] [ENSMUST00000177423] [ENSMUST00000177531]
Predicted Effect probably benign
Transcript: ENSMUST00000001974
SMART Domains Protein: ENSMUSP00000001974
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 55 499 3.5e-151 PFAM
Pfam:Met_10 141 256 1.3e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109767
SMART Domains Protein: ENSMUSP00000105389
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 55 499 4.9e-149 PFAM
Pfam:Met_10 142 256 3.4e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109768
AA Change: V7L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105390
Gene: ENSMUSG00000001909
AA Change: V7L

DomainStartEndE-ValueType
Pfam:TRM 48 492 3.1e-149 PFAM
Pfam:Met_10 135 249 4.4e-8 PFAM
ZnF_C3H1 592 618 3.55e-6 SMART
low complexity region 641 654 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131700
SMART Domains Protein: ENSMUSP00000122526
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 108 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143427
AA Change: V7L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117140
Gene: ENSMUSG00000001909
AA Change: V7L

DomainStartEndE-ValueType
Pfam:TRM 47 98 3.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152301
SMART Domains Protein: ENSMUSP00000116712
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 242 4.2e-49 PFAM
Pfam:Met_10 145 229 2.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177084
SMART Domains Protein: ENSMUSP00000135675
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 29 260 4.1e-76 PFAM
Pfam:Met_10 117 231 4.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177423
AA Change: V7L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135327
Gene: ENSMUSG00000001909
AA Change: V7L

DomainStartEndE-ValueType
Pfam:TRM 47 262 1.4e-66 PFAM
Pfam:Met_10 138 252 5.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177531
SMART Domains Protein: ENSMUSP00000135540
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 174 1.8e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T A 8: 124,861,247 probably null Het
4932415D10Rik T A 10: 82,291,648 N1843Y probably benign Het
Abca13 A T 11: 9,294,371 N2078I probably benign Het
Abcc2 A G 19: 43,819,361 I814V probably benign Het
Adamts4 A G 1: 171,256,624 R557G probably benign Het
Bysl A T 17: 47,601,842 L341Q probably damaging Het
C130026I21Rik A C 1: 85,202,060 probably null Het
Csmd1 C T 8: 17,216,787 G41D probably damaging Het
Dnah11 T C 12: 117,886,676 D4221G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dnajc21 A G 15: 10,470,263 probably null Het
Elavl1 C A 8: 4,289,818 A255S probably damaging Het
Filip1 C T 9: 79,815,839 G1166D probably damaging Het
Gm17727 A G 9: 35,777,125 W55R probably damaging Het
Gnptg T C 17: 25,235,261 Y184C probably damaging Het
Ifit3b A T 19: 34,611,519 S32C probably benign Het
Kcnh7 T G 2: 62,777,596 Y547S probably damaging Het
Lima1 G A 15: 99,783,580 A243V probably damaging Het
Mast3 T A 8: 70,781,966 I67F possibly damaging Het
Ncor1 A C 11: 62,330,819 M1283R probably benign Het
Ndufv1 G A 19: 4,008,749 T253I probably benign Het
Neurog1 G T 13: 56,251,824 Q37K probably benign Het
Nol4 T G 18: 22,920,856 K200Q probably damaging Het
Obscn T C 11: 59,012,801 H7599R probably benign Het
Olfr57 C A 10: 79,035,091 C98* probably null Het
Olfr728 T A 14: 50,140,364 I92F probably damaging Het
Olfr733 T A 14: 50,299,037 I91L probably benign Het
Olfr739 C T 14: 50,425,089 T190I probably benign Het
Olfr96 T C 17: 37,225,899 V258A probably benign Het
Oog4 A G 4: 143,437,875 V362A possibly damaging Het
Oosp1 T A 19: 11,690,950 D23V probably damaging Het
P2rx3 A G 2: 85,035,199 I34T probably damaging Het
Pla2g4a A T 1: 149,842,235 V621E probably benign Het
Prpf39 T G 12: 65,042,563 V25G probably benign Het
Psd T C 19: 46,313,412 K913E probably benign Het
Ptx4 A T 17: 25,122,702 R50S possibly damaging Het
Rex2 A T 4: 147,052,561 M16L probably benign Het
Serac1 A T 17: 6,045,662 V604E probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp6 T A 12: 44,861,275 T187S probably benign Het
Tg G A 15: 66,735,259 C215Y probably damaging Het
Top2b A T 14: 16,407,142 K671* probably null Het
Ttn C T 2: 76,784,830 R15102H probably benign Het
Uhrf1bp1 T A 17: 27,876,925 I70N probably benign Het
Unc79 A T 12: 102,991,430 I35F probably damaging Het
Other mutations in Trmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Trmt1 APN 8 84695509 missense possibly damaging 0.92
IGL01959:Trmt1 APN 8 84691376 splice site probably null
IGL02127:Trmt1 APN 8 84697471 missense probably damaging 1.00
IGL02689:Trmt1 APN 8 84699756 unclassified probably benign
IGL03087:Trmt1 APN 8 84695233 missense probably damaging 1.00
IGL02835:Trmt1 UTSW 8 84696960 missense probably null 1.00
PIT4418001:Trmt1 UTSW 8 84697670 missense probably damaging 0.97
R0395:Trmt1 UTSW 8 84697112 splice site probably null
R0964:Trmt1 UTSW 8 84696852 missense probably damaging 1.00
R1881:Trmt1 UTSW 8 84689267 intron probably benign
R2190:Trmt1 UTSW 8 84689841 nonsense probably null
R2197:Trmt1 UTSW 8 84690858 missense probably damaging 1.00
R2979:Trmt1 UTSW 8 84696882 missense probably damaging 1.00
R3813:Trmt1 UTSW 8 84695217 unclassified probably benign
R4407:Trmt1 UTSW 8 84697755 unclassified probably benign
R4461:Trmt1 UTSW 8 84699149 missense probably benign 0.01
R4588:Trmt1 UTSW 8 84690753 intron probably benign
R5170:Trmt1 UTSW 8 84695232 missense probably damaging 1.00
R6299:Trmt1 UTSW 8 84697290 nonsense probably null
R6666:Trmt1 UTSW 8 84698454 missense probably damaging 1.00
R7669:Trmt1 UTSW 8 84697551 missense probably benign 0.05
R7952:Trmt1 UTSW 8 84689340 missense possibly damaging 0.50
Z1176:Trmt1 UTSW 8 84698240 missense possibly damaging 0.95
Z1176:Trmt1 UTSW 8 84699198 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTGAAACTCCCTTGTAGAAGAGTTG -3'
(R):5'- AAATCCGGTGGCCTCCATAAC -3'

Sequencing Primer
(F):5'- CCCACTGTAGGTAATGTCT -3'
(R):5'- ATAACATCCTGCGTTCTCGAGGG -3'
Posted On2019-02-22