Incidental Mutation 'R6561:Dnmt3c'
ID543544
Institutional Source Beutler Lab
Gene Symbol Dnmt3c
Ensembl Gene ENSMUSG00000082079
Gene NameDNA methyltransferase 3C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6561 (G1)
Quality Score43.0073
Status Validated
Chromosome2
Chromosomal Location153696652-153729907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 153720030 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 551 (L551Q)
Ref Sequence ENSEMBL: ENSMUSP00000153622 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000119996
AA Change: L551Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 97% (30/31)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU or endonuclease-mediated mutation alleles exhibit reduced transposon and retrotransposons in male germ cells, male infertility, meiotic arrest, azoospermia and hypogonadism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,927,825 I468F probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Anapc1 A G 2: 128,663,999 V639A probably damaging Het
Cdh12 A G 15: 21,492,594 Y233C probably damaging Het
Dchs2 G T 3: 83,129,169 V408F probably benign Het
Dock2 A G 11: 34,687,538 F746S probably damaging Het
Fastkd3 C T 13: 68,584,030 R157C possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ier3ip1 T A 18: 76,939,648 S58T probably damaging Het
Itpr2 A G 6: 146,234,006 V1809A probably damaging Het
Kif22 T A 7: 127,031,053 N437I probably benign Het
Klri1 A G 6: 129,717,001 V41A probably benign Het
Lrrc14 T A 15: 76,713,446 D125E possibly damaging Het
Nek10 A T 14: 14,828,448 N90I possibly damaging Het
Nostrin G A 2: 69,180,857 A331T probably benign Het
Olfr1463 A G 19: 13,235,030 Y260C probably damaging Het
Olfr730 T C 14: 50,186,318 K300E probably damaging Het
Olfr870 T C 9: 20,170,777 T265A probably benign Het
Plxna1 A G 6: 89,356,978 V223A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Smg1 A T 7: 118,166,077 probably benign Het
Sorbs1 A G 19: 40,326,052 I772T probably benign Het
Sptbn2 A G 19: 4,747,926 N1927S probably benign Het
Tab1 T C 15: 80,148,830 V105A probably benign Het
Trbv15 A T 6: 41,141,480 T57S probably benign Het
Ttc37 T A 13: 76,150,519 S1115T probably damaging Het
Vmn1r78 A T 7: 12,152,899 I146F probably damaging Het
Vmn2r39 T A 7: 9,015,093 Y748F probably damaging Het
Zfp493 T A 13: 67,786,219 V65D possibly damaging Het
Other mutations in Dnmt3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0479:Dnmt3c UTSW 2 153714941 splice site probably null
R1167:Dnmt3c UTSW 2 153711781 critical splice donor site probably null
R4469:Dnmt3c UTSW 2 153720360 missense possibly damaging 0.94
R6198:Dnmt3c UTSW 2 153720009 missense noncoding transcript
R7030:Dnmt3c UTSW 2 153717425 missense probably damaging 1.00
R7135:Dnmt3c UTSW 2 153714952 splice site probably null
R7296:Dnmt3c UTSW 2 153715026 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GTGCATGCACATGTATACACAC -3'
(R):5'- GAGCAGCAGAGCATTGTTCG -3'

Sequencing Primer
(F):5'- TTGCATGGCAAGTACCTGAAC -3'
(R):5'- AGAGCATTGTTCGCTGCC -3'
Posted On2019-02-27