Incidental Mutation 'R6531:Cux1'
ID 543547
Institutional Source Beutler Lab
Gene Symbol Cux1
Ensembl Gene ENSMUSG00000029705
Gene Name cut-like homeobox 1
Synonyms CDP, Cutl1, Cux, Cux-1
MMRRC Submission 044657-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.892) question?
Stock # R6531 (G1)
Quality Score 45.0072
Status Validated
Chromosome 5
Chromosomal Location 136276989-136596344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 136303973 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1401 (D1401G)
Ref Sequence ENSEMBL: ENSMUSP00000135892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175975] [ENSMUST00000176172] [ENSMUST00000176778]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000004097
AA Change: D1318G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: D1318G

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
CUT 452 538 5.06e-39 SMART
low complexity region 602 608 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
CUT 841 929 3.31e-43 SMART
low complexity region 956 972 N/A INTRINSIC
low complexity region 990 1011 N/A INTRINSIC
CUT 1024 1110 3.78e-38 SMART
HOX 1150 1212 6.32e-15 SMART
low complexity region 1224 1239 N/A INTRINSIC
low complexity region 1317 1379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175975
AA Change: D1396G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705
AA Change: D1396G

DomainStartEndE-ValueType
coiled coil region 1 169 N/A INTRINSIC
low complexity region 235 251 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
CUT 358 444 5.06e-39 SMART
low complexity region 508 514 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
CUT 747 835 3.31e-43 SMART
low complexity region 862 878 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
CUT 930 1016 3.78e-38 SMART
HOX 1056 1118 6.32e-15 SMART
low complexity region 1130 1145 N/A INTRINSIC
low complexity region 1223 1285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176172
AA Change: D1409G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705
AA Change: D1409G

DomainStartEndE-ValueType
coiled coil region 99 354 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
CUT 543 629 5.06e-39 SMART
low complexity region 693 699 N/A INTRINSIC
low complexity region 711 733 N/A INTRINSIC
CUT 932 1020 3.31e-43 SMART
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1081 1102 N/A INTRINSIC
CUT 1115 1201 3.78e-38 SMART
HOX 1241 1303 6.32e-15 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1408 1470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176778
AA Change: D1401G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: D1401G

DomainStartEndE-ValueType
low complexity region 78 86 N/A INTRINSIC
coiled coil region 195 448 N/A INTRINSIC
low complexity region 508 519 N/A INTRINSIC
CUT 535 621 5.06e-39 SMART
low complexity region 685 691 N/A INTRINSIC
low complexity region 703 725 N/A INTRINSIC
CUT 924 1012 3.31e-43 SMART
low complexity region 1039 1055 N/A INTRINSIC
low complexity region 1073 1094 N/A INTRINSIC
CUT 1107 1193 3.78e-38 SMART
HOX 1233 1295 6.32e-15 SMART
low complexity region 1307 1322 N/A INTRINSIC
low complexity region 1400 1462 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,926,980 (GRCm39) E880G possibly damaging Het
Acsbg2 T A 17: 57,153,617 (GRCm39) I529F probably damaging Het
Ahcyl2 T G 6: 29,886,161 (GRCm39) M359R probably benign Het
Aldh5a1 G T 13: 25,102,547 (GRCm39) D305E probably benign Het
Catsper2 C G 2: 121,230,261 (GRCm39) V358L possibly damaging Het
Cd200r4 C T 16: 44,653,868 (GRCm39) Q222* probably null Het
Col4a2 T A 8: 11,458,135 (GRCm39) D270E probably benign Het
Cyp3a59 T A 5: 146,035,027 (GRCm39) M235K probably benign Het
Dock3 T C 9: 106,844,415 (GRCm39) D895G probably benign Het
Dync1h1 T C 12: 110,584,354 (GRCm39) F586L probably damaging Het
Elmo1 G T 13: 20,756,616 (GRCm39) R568L possibly damaging Het
Epb41 T C 4: 131,684,947 (GRCm39) T711A probably benign Het
Grm7 T A 6: 111,335,386 (GRCm39) M599K probably benign Het
Hivep3 A T 4: 119,980,073 (GRCm39) K1704* probably null Het
Ighv1-62-3 C A 12: 115,424,626 (GRCm39) C115F probably damaging Het
Krt78 A G 15: 101,860,708 (GRCm39) Y200H probably benign Het
Lamb2 A T 9: 108,360,925 (GRCm39) H549L possibly damaging Het
Mroh3 A G 1: 136,112,091 (GRCm39) I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,775,161 (GRCm39) probably null Het
Nol6 G T 4: 41,118,154 (GRCm39) P828T probably benign Het
Or1j15 G A 2: 36,459,353 (GRCm39) V248I probably damaging Het
Or4c3 A G 2: 89,851,801 (GRCm39) V203A probably benign Het
Or5m5 A G 2: 85,814,651 (GRCm39) I156V probably benign Het
Or8w1 A G 2: 87,465,873 (GRCm39) Y73H probably damaging Het
Ovgp1 A C 3: 105,894,387 (GRCm39) probably benign Het
Pitpnm3 T A 11: 71,962,313 (GRCm39) Q230L possibly damaging Het
Pkn1 C T 8: 84,396,922 (GRCm39) V910I probably benign Het
Plcb1 T A 2: 135,167,722 (GRCm39) probably null Het
Ppp1r12c A G 7: 4,485,788 (GRCm39) probably null Het
Rassf5 T A 1: 131,172,551 (GRCm39) Q106L possibly damaging Het
Rfc1 T C 5: 65,470,322 (GRCm39) K62E possibly damaging Het
Sf3b1 C T 1: 55,058,554 (GRCm39) E12K probably damaging Het
Slc4a1ap A T 5: 31,705,982 (GRCm39) D691V probably benign Het
Speg T A 1: 75,399,401 (GRCm39) F2283I probably benign Het
Styxl2 A T 1: 165,937,615 (GRCm39) probably null Het
Synj2 A G 17: 6,084,114 (GRCm39) K267E probably damaging Het
Tg A T 15: 66,711,211 (GRCm39) Y991F probably damaging Het
Tlk1 A T 2: 70,572,427 (GRCm39) D380E probably benign Het
Trim43b A T 9: 88,967,418 (GRCm39) L405H probably damaging Het
Ttf2 A G 3: 100,863,576 (GRCm39) I586T probably damaging Het
Ugt2b36 T A 5: 87,229,445 (GRCm39) R213S probably damaging Het
Vmn1r198 T A 13: 22,538,577 (GRCm39) M21K probably benign Het
Wdr35 A T 12: 9,028,685 (GRCm39) Y101F probably benign Het
Zfp367 T C 13: 64,292,064 (GRCm39) Y189C probably damaging Het
Other mutations in Cux1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cux1 APN 5 136,355,650 (GRCm39) missense probably damaging 1.00
IGL00966:Cux1 APN 5 136,340,345 (GRCm39) intron probably benign
IGL01129:Cux1 APN 5 136,333,572 (GRCm39) intron probably benign
IGL01885:Cux1 APN 5 136,337,301 (GRCm39) missense possibly damaging 0.90
IGL01947:Cux1 APN 5 136,303,979 (GRCm39) missense probably benign 0.04
IGL02259:Cux1 APN 5 136,355,687 (GRCm39) missense probably damaging 1.00
IGL02666:Cux1 APN 5 136,304,169 (GRCm39) nonsense probably null
IGL02826:Cux1 APN 5 136,336,857 (GRCm39) missense probably damaging 1.00
IGL03014:Cux1 UTSW 5 136,594,379 (GRCm39) intron probably benign
R0047:Cux1 UTSW 5 136,392,107 (GRCm39) splice site probably benign
R0047:Cux1 UTSW 5 136,392,107 (GRCm39) splice site probably benign
R0057:Cux1 UTSW 5 136,285,136 (GRCm39) missense probably damaging 1.00
R0149:Cux1 UTSW 5 136,308,351 (GRCm39) missense probably damaging 1.00
R0295:Cux1 UTSW 5 136,342,066 (GRCm39) missense probably benign 0.04
R0361:Cux1 UTSW 5 136,308,351 (GRCm39) missense probably damaging 1.00
R0533:Cux1 UTSW 5 136,336,713 (GRCm39) missense probably damaging 1.00
R0630:Cux1 UTSW 5 136,315,689 (GRCm39) missense probably damaging 1.00
R0801:Cux1 UTSW 5 136,355,783 (GRCm39) missense probably damaging 0.97
R0884:Cux1 UTSW 5 136,336,689 (GRCm39) missense probably damaging 1.00
R0976:Cux1 UTSW 5 136,342,144 (GRCm39) missense probably damaging 1.00
R1073:Cux1 UTSW 5 136,281,395 (GRCm39) critical splice donor site probably null
R1222:Cux1 UTSW 5 136,304,003 (GRCm39) missense probably benign 0.18
R1518:Cux1 UTSW 5 136,337,133 (GRCm39) missense probably benign 0.29
R1686:Cux1 UTSW 5 136,304,235 (GRCm39) nonsense probably null
R1687:Cux1 UTSW 5 136,341,523 (GRCm39) missense probably damaging 1.00
R1758:Cux1 UTSW 5 136,421,176 (GRCm39) missense probably damaging 1.00
R1797:Cux1 UTSW 5 136,304,169 (GRCm39) missense probably benign 0.22
R1919:Cux1 UTSW 5 136,392,173 (GRCm39) nonsense probably null
R2051:Cux1 UTSW 5 136,361,512 (GRCm39) missense probably damaging 1.00
R2339:Cux1 UTSW 5 136,315,862 (GRCm39) missense probably damaging 1.00
R3438:Cux1 UTSW 5 136,340,414 (GRCm39) missense probably damaging 0.97
R3713:Cux1 UTSW 5 136,594,397 (GRCm39) intron probably benign
R3800:Cux1 UTSW 5 136,344,887 (GRCm39) missense probably damaging 1.00
R3964:Cux1 UTSW 5 136,311,796 (GRCm39) missense probably damaging 1.00
R4135:Cux1 UTSW 5 136,336,750 (GRCm39) missense probably damaging 1.00
R4198:Cux1 UTSW 5 136,315,702 (GRCm39) missense probably damaging 1.00
R4467:Cux1 UTSW 5 136,341,576 (GRCm39) missense probably damaging 1.00
R4498:Cux1 UTSW 5 136,341,847 (GRCm39) missense probably damaging 1.00
R4622:Cux1 UTSW 5 136,337,154 (GRCm39) missense probably damaging 0.99
R4623:Cux1 UTSW 5 136,337,154 (GRCm39) missense probably damaging 0.99
R4651:Cux1 UTSW 5 136,596,083 (GRCm39) missense probably damaging 1.00
R4652:Cux1 UTSW 5 136,596,083 (GRCm39) missense probably damaging 1.00
R4658:Cux1 UTSW 5 136,279,448 (GRCm39) missense possibly damaging 0.80
R4665:Cux1 UTSW 5 136,315,653 (GRCm39) missense probably damaging 1.00
R4704:Cux1 UTSW 5 136,278,055 (GRCm39) missense probably benign 0.01
R4867:Cux1 UTSW 5 136,303,815 (GRCm39) intron probably benign
R4965:Cux1 UTSW 5 136,340,410 (GRCm39) missense possibly damaging 0.77
R5090:Cux1 UTSW 5 136,342,054 (GRCm39) missense possibly damaging 0.95
R5155:Cux1 UTSW 5 136,594,295 (GRCm39) intron probably benign
R5226:Cux1 UTSW 5 136,399,027 (GRCm39) missense probably benign 0.01
R5252:Cux1 UTSW 5 136,337,151 (GRCm39) missense probably damaging 0.98
R5266:Cux1 UTSW 5 136,341,548 (GRCm39) missense probably damaging 1.00
R5399:Cux1 UTSW 5 136,281,458 (GRCm39) missense possibly damaging 0.58
R5509:Cux1 UTSW 5 136,304,171 (GRCm39) missense probably benign 0.13
R5609:Cux1 UTSW 5 136,421,174 (GRCm39) missense probably damaging 1.00
R5681:Cux1 UTSW 5 136,337,038 (GRCm39) missense probably damaging 1.00
R5993:Cux1 UTSW 5 136,392,125 (GRCm39) missense probably benign 0.00
R6049:Cux1 UTSW 5 136,361,564 (GRCm39) missense probably damaging 1.00
R6290:Cux1 UTSW 5 136,340,412 (GRCm39) missense probably damaging 0.99
R6310:Cux1 UTSW 5 136,304,018 (GRCm39) missense probably benign 0.10
R6351:Cux1 UTSW 5 136,338,646 (GRCm39) missense probably damaging 1.00
R6590:Cux1 UTSW 5 136,368,971 (GRCm39) missense probably damaging 0.99
R6663:Cux1 UTSW 5 136,514,701 (GRCm39) missense probably damaging 1.00
R6690:Cux1 UTSW 5 136,368,971 (GRCm39) missense probably damaging 0.99
R6777:Cux1 UTSW 5 136,594,422 (GRCm39) intron probably benign
R6786:Cux1 UTSW 5 136,596,085 (GRCm39) missense probably damaging 1.00
R6817:Cux1 UTSW 5 136,402,027 (GRCm39) splice site probably null
R6989:Cux1 UTSW 5 136,308,502 (GRCm39) nonsense probably null
R7011:Cux1 UTSW 5 136,388,887 (GRCm39) missense probably damaging 1.00
R7167:Cux1 UTSW 5 136,338,895 (GRCm39) splice site probably null
R7699:Cux1 UTSW 5 136,514,593 (GRCm39) critical splice donor site probably null
R7861:Cux1 UTSW 5 136,281,458 (GRCm39) missense possibly damaging 0.58
R7876:Cux1 UTSW 5 136,392,161 (GRCm39) missense probably benign 0.00
R7916:Cux1 UTSW 5 136,311,815 (GRCm39) missense probably damaging 1.00
R8023:Cux1 UTSW 5 136,402,251 (GRCm39) missense probably damaging 0.99
R8154:Cux1 UTSW 5 136,281,434 (GRCm39) missense probably damaging 1.00
R8267:Cux1 UTSW 5 136,311,853 (GRCm39) missense probably damaging 1.00
R8289:Cux1 UTSW 5 136,337,358 (GRCm39) missense probably damaging 0.99
R8305:Cux1 UTSW 5 136,388,863 (GRCm39) missense probably benign 0.02
R8319:Cux1 UTSW 5 136,594,251 (GRCm39) missense probably benign 0.02
R8405:Cux1 UTSW 5 136,304,241 (GRCm39) missense possibly damaging 0.83
R8483:Cux1 UTSW 5 136,303,944 (GRCm39) missense possibly damaging 0.83
R8506:Cux1 UTSW 5 136,337,358 (GRCm39) missense probably damaging 0.99
R8671:Cux1 UTSW 5 136,279,454 (GRCm39) missense probably damaging 1.00
R8680:Cux1 UTSW 5 136,336,710 (GRCm39) missense possibly damaging 0.46
R8737:Cux1 UTSW 5 136,311,796 (GRCm39) missense probably damaging 1.00
R8738:Cux1 UTSW 5 136,402,220 (GRCm39) missense probably damaging 1.00
R8793:Cux1 UTSW 5 136,594,539 (GRCm39) missense unknown
R8897:Cux1 UTSW 5 136,315,623 (GRCm39) missense probably damaging 1.00
R8926:Cux1 UTSW 5 136,338,404 (GRCm39) intron probably benign
R8954:Cux1 UTSW 5 136,402,203 (GRCm39) nonsense probably null
R9092:Cux1 UTSW 5 136,514,671 (GRCm39) missense probably damaging 1.00
R9205:Cux1 UTSW 5 136,398,989 (GRCm39) missense probably damaging 1.00
R9550:Cux1 UTSW 5 136,340,387 (GRCm39) missense probably damaging 0.99
R9578:Cux1 UTSW 5 136,282,919 (GRCm39) critical splice donor site probably null
R9682:Cux1 UTSW 5 136,337,116 (GRCm39) missense probably benign
R9701:Cux1 UTSW 5 136,343,169 (GRCm39) missense probably damaging 0.97
R9712:Cux1 UTSW 5 136,338,673 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TGTTCAAGTTCGCAGCCTTC -3'
(R):5'- TAGTGGCCACCAAGTCTCAG -3'

Sequencing Primer
(F):5'- TCTGCAGTGAGCTAGGCCTTC -3'
(R):5'- CAAGTCTCAGGGAGGGCTG -3'
Posted On 2019-02-27