Incidental Mutation 'R6626:Flnb'
ID 543555
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Name filamin, beta
Synonyms
MMRRC Submission 044748-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6626 (G1)
Quality Score 54.0072
Status Validated
Chromosome 14
Chromosomal Location 14518185-14651816 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 7929012 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 1914 (R1914C)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
AlphaFold Q80X90
Predicted Effect probably damaging
Transcript: ENSMUST00000052678
AA Change: R1914C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: R1914C

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik T C 11: 3,888,056 (GRCm39) H110R unknown Het
Adgrv1 T A 13: 81,666,245 (GRCm39) D1937V probably damaging Het
Ank1 T A 8: 23,465,207 (GRCm39) L19H probably damaging Het
Bcl9 C T 3: 97,122,712 (GRCm39) R29H probably benign Het
Boc A T 16: 44,340,803 (GRCm39) I49N possibly damaging Het
C8a T C 4: 104,703,164 (GRCm39) I298V probably benign Het
Cacna1s T C 1: 136,022,703 (GRCm39) S879P probably damaging Het
Cacna2d3 T C 14: 28,786,143 (GRCm39) probably benign Het
Dnm1 A G 2: 32,230,892 (GRCm39) I63T probably damaging Het
Gm9493 A T 19: 23,597,209 (GRCm39) K35M possibly damaging Het
Gpld1 T C 13: 25,163,953 (GRCm39) S552P probably damaging Het
Hacd1 T A 2: 14,031,755 (GRCm39) I243F probably benign Het
Klhdc4 A G 8: 122,546,901 (GRCm39) V110A probably benign Het
Krt26 C T 11: 99,220,528 (GRCm39) V441M probably benign Het
Muc6 G A 7: 141,223,981 (GRCm39) probably benign Het
Nav2 A G 7: 49,244,100 (GRCm39) Y2109C probably damaging Het
Ncbp3 T A 11: 72,964,210 (GRCm39) S387T possibly damaging Het
Notch2 T G 3: 98,008,921 (GRCm39) V513G probably damaging Het
Nt5c1b A T 12: 10,424,837 (GRCm39) R128* probably null Het
Olig2 T C 16: 91,024,044 (GRCm39) S253P unknown Het
Or6b1 A G 6: 42,815,582 (GRCm39) M256V probably benign Het
Or8g17 A G 9: 38,930,402 (GRCm39) V145A possibly damaging Het
Or8k53 C T 2: 86,177,364 (GRCm39) V249I possibly damaging Het
Phkb T A 8: 86,648,780 (GRCm39) F199I probably damaging Het
Rnf17 A G 14: 56,665,381 (GRCm39) T178A possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,229,115 (GRCm39) probably benign Homo
Sfxn2 A T 19: 46,570,967 (GRCm39) N9I possibly damaging Het
Slc16a4 G A 3: 107,208,512 (GRCm39) A341T possibly damaging Het
Spata31h1 A G 10: 82,128,667 (GRCm39) F1448L probably benign Het
Tank T A 2: 61,480,640 (GRCm39) probably benign Het
Tnr A T 1: 159,677,822 (GRCm39) Y69F probably damaging Het
Trp53bp1 T C 2: 121,038,284 (GRCm39) D1518G probably damaging Het
Txndc16 T C 14: 45,398,792 (GRCm39) probably null Het
Ugp2 A G 11: 21,281,028 (GRCm39) Y227H probably damaging Het
Vps50 G A 6: 3,551,101 (GRCm39) W388* probably null Het
Zfp516 T A 18: 83,006,232 (GRCm39) D1045E probably damaging Het
Zscan10 C T 17: 23,824,831 (GRCm39) P96S probably damaging Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7,917,390 (GRCm38) splice site probably benign
IGL01063:Flnb APN 14 7,926,518 (GRCm38) splice site probably benign
IGL01135:Flnb APN 14 7,909,736 (GRCm38) missense probably benign
IGL01139:Flnb APN 14 7,945,989 (GRCm38) missense probably damaging 1.00
IGL01364:Flnb APN 14 7,934,562 (GRCm38) critical splice acceptor site probably null
IGL01417:Flnb APN 14 7,905,513 (GRCm38) missense probably damaging 0.99
IGL01505:Flnb APN 14 7,902,003 (GRCm38) critical splice donor site probably null
IGL01560:Flnb APN 14 7,893,829 (GRCm38) missense probably benign 0.07
IGL01621:Flnb APN 14 7,950,470 (GRCm38) missense probably damaging 1.00
IGL01656:Flnb APN 14 7,902,010 (GRCm38) splice site probably benign
IGL01889:Flnb APN 14 7,935,967 (GRCm38) missense possibly damaging 0.85
IGL01987:Flnb APN 14 7,922,748 (GRCm38) critical splice donor site probably null
IGL02322:Flnb APN 14 7,894,676 (GRCm38) missense probably damaging 1.00
IGL02496:Flnb APN 14 7,930,919 (GRCm38) splice site probably benign
IGL02752:Flnb APN 14 7,917,338 (GRCm38) missense probably benign
IGL03001:Flnb APN 14 7,934,680 (GRCm38) missense probably damaging 0.99
IGL03076:Flnb APN 14 7,901,988 (GRCm38) missense probably benign 0.01
IGL03085:Flnb APN 14 7,882,211 (GRCm38) missense probably benign
IGL03170:Flnb APN 14 7,818,261 (GRCm38) missense possibly damaging 0.90
IGL03373:Flnb APN 14 7,890,867 (GRCm38) critical splice donor site probably null
Boomerang UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
Queensland UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
Rhodelinda UTSW 14 7,887,682 (GRCm38) splice site probably benign
saul UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
Xerxes UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0084:Flnb UTSW 14 7,935,979 (GRCm38) missense probably benign
R0128:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0130:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0148:Flnb UTSW 14 7,939,077 (GRCm38) missense probably benign 0.01
R0166:Flnb UTSW 14 7,896,115 (GRCm38) missense probably damaging 1.00
R0376:Flnb UTSW 14 7,946,014 (GRCm38) critical splice donor site probably null
R0547:Flnb UTSW 14 7,912,943 (GRCm38) splice site probably null
R0612:Flnb UTSW 14 7,887,682 (GRCm38) splice site probably benign
R0656:Flnb UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R0691:Flnb UTSW 14 7,890,810 (GRCm38) missense probably benign 0.16
R1241:Flnb UTSW 14 7,896,503 (GRCm38) missense probably benign 0.06
R1572:Flnb UTSW 14 7,883,908 (GRCm38) missense probably damaging 0.97
R1682:Flnb UTSW 14 7,913,121 (GRCm38) missense probably benign 0.04
R1807:Flnb UTSW 14 7,934,645 (GRCm38) missense probably benign 0.26
R1848:Flnb UTSW 14 7,892,113 (GRCm38) missense probably damaging 1.00
R1959:Flnb UTSW 14 7,884,735 (GRCm38) nonsense probably null
R2078:Flnb UTSW 14 7,927,466 (GRCm38) missense probably damaging 1.00
R2132:Flnb UTSW 14 7,873,376 (GRCm38) missense probably benign 0.04
R2209:Flnb UTSW 14 7,905,507 (GRCm38) nonsense probably null
R2212:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2213:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2363:Flnb UTSW 14 7,945,950 (GRCm38) missense possibly damaging 0.95
R2415:Flnb UTSW 14 7,929,932 (GRCm38) missense probably benign 0.07
R2983:Flnb UTSW 14 7,882,250 (GRCm38) missense probably damaging 1.00
R3001:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3002:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3436:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3437:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3778:Flnb UTSW 14 7,915,353 (GRCm38) missense probably benign 0.06
R3783:Flnb UTSW 14 7,889,236 (GRCm38) missense probably benign 0.04
R4162:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4163:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4164:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4356:Flnb UTSW 14 7,922,700 (GRCm38) missense probably benign
R4369:Flnb UTSW 14 7,942,216 (GRCm38) missense probably benign
R4783:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4785:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4790:Flnb UTSW 14 7,905,661 (GRCm38) missense probably benign 0.34
R4828:Flnb UTSW 14 7,919,238 (GRCm38) missense probably benign 0.13
R4882:Flnb UTSW 14 7,929,936 (GRCm38) missense possibly damaging 0.56
R5002:Flnb UTSW 14 7,945,882 (GRCm38) missense probably damaging 1.00
R5058:Flnb UTSW 14 7,924,262 (GRCm38) nonsense probably null
R5184:Flnb UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
R5186:Flnb UTSW 14 7,909,748 (GRCm38) missense probably damaging 1.00
R5395:Flnb UTSW 14 7,883,881 (GRCm38) missense probably benign 0.02
R5421:Flnb UTSW 14 7,926,494 (GRCm38) missense probably damaging 1.00
R5667:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5671:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5714:Flnb UTSW 14 7,929,073 (GRCm38) missense probably damaging 1.00
R5860:Flnb UTSW 14 7,931,135 (GRCm38) missense probably damaging 1.00
R5892:Flnb UTSW 14 7,907,183 (GRCm38) missense probably damaging 1.00
R5924:Flnb UTSW 14 7,890,765 (GRCm38) missense probably benign 0.00
R6131:Flnb UTSW 14 7,894,635 (GRCm38) missense possibly damaging 0.79
R6244:Flnb UTSW 14 7,892,092 (GRCm38) missense probably damaging 1.00
R6489:Flnb UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R6582:Flnb UTSW 14 7,892,275 (GRCm38) critical splice donor site probably null
R6586:Flnb UTSW 14 7,929,138 (GRCm38) missense possibly damaging 0.93
R6611:Flnb UTSW 14 7,915,318 (GRCm38) missense probably damaging 1.00
R6700:Flnb UTSW 14 7,892,189 (GRCm38) missense probably damaging 0.99
R6738:Flnb UTSW 14 7,904,536 (GRCm38) missense probably benign 0.01
R6864:Flnb UTSW 14 7,905,640 (GRCm38) missense possibly damaging 0.84
R6916:Flnb UTSW 14 7,907,171 (GRCm38) missense probably damaging 0.99
R7117:Flnb UTSW 14 7,894,214 (GRCm38) missense probably benign 0.02
R7164:Flnb UTSW 14 7,915,944 (GRCm38) splice site probably null
R7328:Flnb UTSW 14 7,894,660 (GRCm38) nonsense probably null
R7328:Flnb UTSW 14 7,883,788 (GRCm38) missense possibly damaging 0.95
R7687:Flnb UTSW 14 7,924,224 (GRCm38) missense probably damaging 1.00
R7716:Flnb UTSW 14 7,917,274 (GRCm38) missense possibly damaging 0.64
R7763:Flnb UTSW 14 7,926,478 (GRCm38) missense probably benign 0.00
R7821:Flnb UTSW 14 7,939,113 (GRCm38) missense probably benign 0.00
R7921:Flnb UTSW 14 7,933,800 (GRCm38) missense possibly damaging 0.57
R8008:Flnb UTSW 14 7,892,155 (GRCm38) missense probably damaging 1.00
R8075:Flnb UTSW 14 7,913,048 (GRCm38) missense probably benign 0.00
R8084:Flnb UTSW 14 7,907,243 (GRCm38) missense probably benign 0.00
R8259:Flnb UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
R8441:Flnb UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
R8493:Flnb UTSW 14 7,869,822 (GRCm38) missense probably damaging 0.97
R8508:Flnb UTSW 14 7,950,394 (GRCm38) missense probably damaging 0.98
R8531:Flnb UTSW 14 7,929,939 (GRCm38) missense probably damaging 1.00
R8812:Flnb UTSW 14 7,887,624 (GRCm38) missense probably benign 0.06
R8814:Flnb UTSW 14 7,927,409 (GRCm38) missense probably damaging 1.00
R8825:Flnb UTSW 14 7,887,566 (GRCm38) missense probably damaging 1.00
R8868:Flnb UTSW 14 7,908,671 (GRCm38) missense probably benign 0.02
R8955:Flnb UTSW 14 7,904,688 (GRCm38) nonsense probably null
R8955:Flnb UTSW 14 7,892,874 (GRCm38) missense probably damaging 1.00
R8976:Flnb UTSW 14 7,901,882 (GRCm38) critical splice acceptor site probably null
R9055:Flnb UTSW 14 7,908,553 (GRCm38) missense probably benign 0.00
R9148:Flnb UTSW 14 7,817,996 (GRCm38) start gained probably benign
R9179:Flnb UTSW 14 7,887,541 (GRCm38) nonsense probably null
R9180:Flnb UTSW 14 7,818,219 (GRCm38) missense probably damaging 1.00
R9189:Flnb UTSW 14 7,892,976 (GRCm38) missense possibly damaging 0.90
R9286:Flnb UTSW 14 7,873,414 (GRCm38) missense probably damaging 0.98
R9288:Flnb UTSW 14 7,904,498 (GRCm38) missense probably benign 0.43
R9354:Flnb UTSW 14 7,818,411 (GRCm38) missense probably benign 0.13
R9484:Flnb UTSW 14 7,929,004 (GRCm38) missense probably benign 0.06
R9505:Flnb UTSW 14 7,904,665 (GRCm38) missense probably benign
R9525:Flnb UTSW 14 7,905,481 (GRCm38) missense probably damaging 1.00
R9621:Flnb UTSW 14 7,926,421 (GRCm38) missense probably damaging 0.99
R9630:Flnb UTSW 14 7,926,438 (GRCm38) nonsense probably null
R9739:Flnb UTSW 14 7,935,954 (GRCm38) nonsense probably null
R9760:Flnb UTSW 14 7,929,846 (GRCm38) missense probably damaging 0.98
X0066:Flnb UTSW 14 7,908,636 (GRCm38) missense probably damaging 1.00
Z1088:Flnb UTSW 14 7,905,871 (GRCm38) missense probably benign 0.04
Z1176:Flnb UTSW 14 7,942,066 (GRCm38) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GTCATAACCACCCATTGTCCTG -3'
(R):5'- TCACCCACTTCCTAAGGAGTC -3'

Sequencing Primer
(F):5'- GCCGTGGTCATTATATACTCATTG -3'
(R):5'- CACTTCCTAAGGAGTCTCTGC -3'
Posted On 2019-03-04