Incidental Mutation 'R6632:Cnot1'
ID 543560
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene Name CCR4-NOT transcription complex, subunit 1
Synonyms 6030411K04Rik
MMRRC Submission 044754-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6632 (G1)
Quality Score 66.0074
Status Validated
Chromosome 8
Chromosomal Location 96446079-96534092 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 96499895 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000212323] [ENSMUST00000213006] [ENSMUST00000213046]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000068452
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098473
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211887
Predicted Effect unknown
Transcript: ENSMUST00000212323
AA Change: S200P
Predicted Effect probably benign
Transcript: ENSMUST00000213006
Predicted Effect probably benign
Transcript: ENSMUST00000213046
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,429,186 (GRCm39) S758P possibly damaging Het
Abca3 C G 17: 24,603,444 (GRCm39) D545E probably benign Het
Akap9 T A 5: 4,063,842 (GRCm39) probably null Het
Akr1b1 C T 6: 34,286,939 (GRCm39) V206M possibly damaging Het
Arpp21 G A 9: 111,956,424 (GRCm39) Q518* probably null Het
Atp9b G A 18: 80,851,864 (GRCm39) R410W probably damaging Het
Cacna2d3 T C 14: 28,627,222 (GRCm39) *265W probably null Het
Ccdc96 G A 5: 36,642,533 (GRCm39) E180K probably benign Het
Cep164 T C 9: 45,691,088 (GRCm39) K1231E possibly damaging Het
Cpne2 T C 8: 95,281,583 (GRCm39) V206A probably benign Het
Dchs1 A G 7: 105,411,085 (GRCm39) Y1647H probably damaging Het
Dnaaf5 A G 5: 139,156,088 (GRCm39) T590A probably benign Het
Eif4g1 A T 16: 20,504,270 (GRCm39) I1068F probably damaging Het
Ephb4 A T 5: 137,364,849 (GRCm39) K639N probably damaging Het
Gcc2 A G 10: 58,105,871 (GRCm39) probably null Het
Gm35315 A C 5: 110,227,129 (GRCm39) Y103* probably null Het
Hsd17b4 A G 18: 50,312,169 (GRCm39) K578R possibly damaging Het
Ice2 T C 9: 69,335,734 (GRCm39) S906P probably benign Het
Irx4 G T 13: 73,416,545 (GRCm39) A314S probably benign Het
Lama5 G A 2: 179,833,455 (GRCm39) P1519L probably damaging Het
Lrp1b A T 2: 40,615,454 (GRCm39) W3650R probably benign Het
Mcoln3 C T 3: 145,833,942 (GRCm39) H161Y probably benign Het
Mphosph10 A T 7: 64,035,567 (GRCm39) M368K probably damaging Het
Msh2 A C 17: 88,020,094 (GRCm39) K567Q possibly damaging Het
N4bp3 T C 11: 51,534,776 (GRCm39) E429G possibly damaging Het
Nrxn3 G A 12: 89,159,924 (GRCm39) A17T probably damaging Het
Or2aj6 T C 16: 19,443,773 (GRCm39) T26A probably benign Het
Or5b106 T A 19: 13,123,552 (GRCm39) Y157F probably benign Het
P4ha2 G T 11: 54,008,474 (GRCm39) R227L probably benign Het
Pfkfb4 G A 9: 108,838,630 (GRCm39) probably null Het
Ror1 A G 4: 100,299,303 (GRCm39) N892S probably benign Het
Scn9a G T 2: 66,313,846 (GRCm39) D1957E probably benign Het
Sec24a A T 11: 51,604,476 (GRCm39) Y713* probably null Het
Serpinb1b T A 13: 33,271,438 (GRCm39) F70I probably damaging Het
Setdb1 T C 3: 95,231,460 (GRCm39) Y1284C probably damaging Het
Suco A T 1: 161,655,809 (GRCm39) M1030K possibly damaging Het
Syne1 A T 10: 5,165,667 (GRCm39) probably null Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 96,452,707 (GRCm39) missense probably damaging 1.00
IGL01340:Cnot1 APN 8 96,487,165 (GRCm39) missense probably damaging 1.00
IGL01457:Cnot1 APN 8 96,467,637 (GRCm39) missense probably damaging 1.00
IGL01505:Cnot1 APN 8 96,455,346 (GRCm39) missense probably damaging 0.98
IGL02401:Cnot1 APN 8 96,482,761 (GRCm39) missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 96,500,113 (GRCm39) missense probably damaging 1.00
IGL02696:Cnot1 APN 8 96,471,645 (GRCm39) missense probably benign 0.00
IGL02754:Cnot1 APN 8 96,481,706 (GRCm39) missense probably benign 0.03
IGL03092:Cnot1 APN 8 96,496,243 (GRCm39) intron probably benign
IGL03174:Cnot1 APN 8 96,487,983 (GRCm39) missense probably damaging 1.00
IGL03310:Cnot1 APN 8 96,462,308 (GRCm39) splice site probably benign
IGL03371:Cnot1 APN 8 96,501,344 (GRCm39) missense possibly damaging 0.85
Affiliate UTSW 8 96,491,753 (GRCm39) missense probably damaging 0.99
Barge UTSW 8 96,460,757 (GRCm39) missense probably benign 0.13
Byproduct UTSW 8 96,472,275 (GRCm39) frame shift probably null
Chairman UTSW 8 96,491,655 (GRCm39) missense possibly damaging 0.95
cohort UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
Director UTSW 8 96,491,690 (GRCm39) missense probably benign 0.15
kowloon UTSW 8 96,515,286 (GRCm39) missense probably damaging 1.00
Quorum UTSW 8 96,452,746 (GRCm39) missense probably damaging 1.00
tugboat UTSW 8 96,500,246 (GRCm39) missense probably damaging 0.99
Xiao UTSW 8 96,457,048 (GRCm39) missense probably damaging 1.00
BB001:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB003:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB011:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB013:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R0008:Cnot1 UTSW 8 96,487,969 (GRCm39) missense probably damaging 1.00
R0008:Cnot1 UTSW 8 96,487,969 (GRCm39) missense probably damaging 1.00
R0091:Cnot1 UTSW 8 96,489,772 (GRCm39) missense probably damaging 1.00
R0335:Cnot1 UTSW 8 96,498,628 (GRCm39) missense probably benign 0.02
R0409:Cnot1 UTSW 8 96,475,483 (GRCm39) missense probably damaging 0.96
R0445:Cnot1 UTSW 8 96,486,836 (GRCm39) missense probably damaging 1.00
R1505:Cnot1 UTSW 8 96,455,295 (GRCm39) missense probably damaging 1.00
R1517:Cnot1 UTSW 8 96,469,841 (GRCm39) missense probably benign 0.38
R1640:Cnot1 UTSW 8 96,496,460 (GRCm39) missense probably damaging 0.98
R1737:Cnot1 UTSW 8 96,474,904 (GRCm39) missense probably damaging 0.98
R1755:Cnot1 UTSW 8 96,451,205 (GRCm39) missense probably damaging 1.00
R1901:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 96,468,572 (GRCm39) missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 96,451,221 (GRCm39) missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 96,466,469 (GRCm39) missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 96,501,986 (GRCm39) missense probably damaging 1.00
R2116:Cnot1 UTSW 8 96,452,781 (GRCm39) missense probably damaging 1.00
R2191:Cnot1 UTSW 8 96,488,054 (GRCm39) missense probably damaging 0.98
R2238:Cnot1 UTSW 8 96,496,149 (GRCm39) missense probably benign 0.04
R2239:Cnot1 UTSW 8 96,496,149 (GRCm39) missense probably benign 0.04
R2251:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2252:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2253:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2315:Cnot1 UTSW 8 96,475,690 (GRCm39) missense probably damaging 1.00
R2431:Cnot1 UTSW 8 96,501,280 (GRCm39) missense probably damaging 1.00
R2988:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
R3109:Cnot1 UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
R3114:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 96,500,246 (GRCm39) missense probably damaging 0.99
R4359:Cnot1 UTSW 8 96,466,476 (GRCm39) missense probably damaging 1.00
R4382:Cnot1 UTSW 8 96,496,407 (GRCm39) missense probably damaging 0.97
R4747:Cnot1 UTSW 8 96,501,310 (GRCm39) missense probably benign 0.27
R4910:Cnot1 UTSW 8 96,459,859 (GRCm39) missense probably benign 0.43
R4913:Cnot1 UTSW 8 96,489,695 (GRCm39) missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 96,448,254 (GRCm39) missense probably damaging 1.00
R5056:Cnot1 UTSW 8 96,467,636 (GRCm39) missense probably damaging 1.00
R5092:Cnot1 UTSW 8 96,479,396 (GRCm39) missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 96,486,815 (GRCm39) missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 96,483,983 (GRCm39) missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 96,470,924 (GRCm39) missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 96,460,775 (GRCm39) nonsense probably null
R5956:Cnot1 UTSW 8 96,481,606 (GRCm39) critical splice donor site probably null
R5981:Cnot1 UTSW 8 96,515,293 (GRCm39) missense probably damaging 1.00
R6093:Cnot1 UTSW 8 96,475,522 (GRCm39) missense probably benign 0.03
R6108:Cnot1 UTSW 8 96,457,048 (GRCm39) missense probably damaging 1.00
R6261:Cnot1 UTSW 8 96,468,549 (GRCm39) missense probably benign 0.00
R6882:Cnot1 UTSW 8 96,447,054 (GRCm39) missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 96,451,160 (GRCm39) missense probably damaging 1.00
R6985:Cnot1 UTSW 8 96,460,757 (GRCm39) missense probably benign 0.13
R7210:Cnot1 UTSW 8 96,515,286 (GRCm39) missense probably damaging 1.00
R7410:Cnot1 UTSW 8 96,459,787 (GRCm39) missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 96,454,276 (GRCm39) missense probably damaging 1.00
R7624:Cnot1 UTSW 8 96,478,447 (GRCm39) missense probably damaging 1.00
R7695:Cnot1 UTSW 8 96,497,260 (GRCm39) missense probably benign 0.03
R7703:Cnot1 UTSW 8 96,486,726 (GRCm39) critical splice donor site probably null
R7771:Cnot1 UTSW 8 96,491,753 (GRCm39) missense probably damaging 0.99
R7800:Cnot1 UTSW 8 96,491,690 (GRCm39) missense probably benign 0.15
R7809:Cnot1 UTSW 8 96,478,406 (GRCm39) missense probably damaging 1.00
R7857:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7914:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7924:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7926:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7981:Cnot1 UTSW 8 96,489,797 (GRCm39) missense probably damaging 1.00
R8004:Cnot1 UTSW 8 96,479,380 (GRCm39) missense probably benign 0.03
R8061:Cnot1 UTSW 8 96,491,655 (GRCm39) missense possibly damaging 0.95
R8185:Cnot1 UTSW 8 96,487,979 (GRCm39) missense probably damaging 1.00
R8269:Cnot1 UTSW 8 96,478,389 (GRCm39) missense probably damaging 1.00
R8306:Cnot1 UTSW 8 96,473,649 (GRCm39) missense probably benign 0.05
R8322:Cnot1 UTSW 8 96,496,472 (GRCm39) missense probably benign 0.00
R8427:Cnot1 UTSW 8 96,460,952 (GRCm39) missense probably benign 0.01
R8723:Cnot1 UTSW 8 96,462,907 (GRCm39) missense probably benign 0.00
R8934:Cnot1 UTSW 8 96,491,695 (GRCm39) missense probably benign 0.04
R9025:Cnot1 UTSW 8 96,475,660 (GRCm39) missense probably benign
R9179:Cnot1 UTSW 8 96,500,054 (GRCm39) missense probably benign 0.16
R9280:Cnot1 UTSW 8 96,497,227 (GRCm39) missense probably benign 0.15
R9285:Cnot1 UTSW 8 96,452,746 (GRCm39) missense probably damaging 1.00
R9299:Cnot1 UTSW 8 96,468,448 (GRCm39) missense probably damaging 1.00
R9337:Cnot1 UTSW 8 96,468,448 (GRCm39) missense probably damaging 1.00
R9480:Cnot1 UTSW 8 96,497,338 (GRCm39) missense possibly damaging 0.94
R9548:Cnot1 UTSW 8 96,482,854 (GRCm39) missense probably benign 0.02
R9601:Cnot1 UTSW 8 96,482,835 (GRCm39) missense probably benign 0.02
R9629:Cnot1 UTSW 8 96,455,874 (GRCm39) missense probably damaging 0.98
R9752:Cnot1 UTSW 8 96,488,019 (GRCm39) missense probably damaging 1.00
R9764:Cnot1 UTSW 8 96,496,209 (GRCm39) missense probably benign 0.00
R9789:Cnot1 UTSW 8 96,455,772 (GRCm39) missense probably damaging 1.00
X0050:Cnot1 UTSW 8 96,469,726 (GRCm39) splice site probably null
Z1176:Cnot1 UTSW 8 96,474,905 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CAGAGTGAATTCCAGGACAGCC -3'
(R):5'- TCTTCTAGCCCAGATCTCAGG -3'

Sequencing Primer
(F):5'- GGGCTACTCAGAGAAACCCTGTC -3'
(R):5'- CCCAGATCTCAGGGGTTTTG -3'
Posted On 2019-03-04