Incidental Mutation 'R6717:Hoxd9'
ID543561
Institutional Source Beutler Lab
Gene Symbol Hoxd9
Ensembl Gene ENSMUSG00000043342
Gene Namehomeobox D9
SynonymsHox-5.2, Hox-4.4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6717 (G1)
Quality Score75.0075
Status Validated
Chromosome2
Chromosomal Location74697727-74700208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74698389 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 112 (P112S)
Ref Sequence ENSEMBL: ENSMUSP00000058490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059272]
Predicted Effect probably benign
Transcript: ENSMUST00000059272
AA Change: P112S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000058490
Gene: ENSMUSG00000043342
AA Change: P112S

DomainStartEndE-ValueType
Pfam:Hox9_act 1 126 2e-47 PFAM
low complexity region 155 176 N/A INTRINSIC
low complexity region 208 225 N/A INTRINSIC
low complexity region 248 256 N/A INTRINSIC
HOX 272 334 6.25e-28 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The exact role of this gene has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit anterior transformation of lumbar, sacral, and caudal vertebrae with abnormal humerus morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Hoxd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0723:Hoxd9 UTSW 2 74698828 missense probably damaging 1.00
R3743:Hoxd9 UTSW 2 74698366 missense probably damaging 0.99
R4155:Hoxd9 UTSW 2 74699323 missense probably benign 0.15
R4261:Hoxd9 UTSW 2 74695687 unclassified probably benign
R5794:Hoxd9 UTSW 2 74699273 missense probably damaging 1.00
R6114:Hoxd9 UTSW 2 74699365 missense probably damaging 1.00
R6197:Hoxd9 UTSW 2 74698822 missense probably damaging 0.99
R6248:Hoxd9 UTSW 2 74698636 missense probably benign 0.09
R6268:Hoxd9 UTSW 2 74698089 missense probably damaging 1.00
R6809:Hoxd9 UTSW 2 74699246 missense probably damaging 1.00
R7183:Hoxd9 UTSW 2 74698365 missense possibly damaging 0.59
R7254:Hoxd9 UTSW 2 74698374 missense probably damaging 1.00
Z1176:Hoxd9 UTSW 2 74698128 missense probably damaging 0.99
Z1177:Hoxd9 UTSW 2 74698525 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACTACGTGGACTCGCTCATAGG -3'
(R):5'- CGAGTTGCACGGGAATTCTG -3'

Sequencing Primer
(F):5'- GACTCGCTCATAGGCCATG -3'
(R):5'- CGGAGCACTCAGTCCTTTTGG -3'
Posted On2019-03-06