Incidental Mutation 'R6717:Mst1'
ID543563
Institutional Source Beutler Lab
Gene Symbol Mst1
Ensembl Gene ENSMUSG00000032591
Gene Namemacrophage stimulating 1 (hepatocyte growth factor-like)
SynonymsD9H3F15S2, DNF15S2h, D3F15S2h, Hgfl
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6717 (G1)
Quality Score158.009
Status Validated
Chromosome9
Chromosomal Location108080436-108085003 bp(+) (GRCm38)
Type of Mutationintron (2249 bp from exon)
DNA Base Change (assembly) T to C at 108080575 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035211] [ENSMUST00000159372] [ENSMUST00000160249] [ENSMUST00000162886]
Predicted Effect probably benign
Transcript: ENSMUST00000035211
SMART Domains Protein: ENSMUSP00000035211
Gene: ENSMUSG00000032591

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 8.57e-46 SMART
KR 290 372 7.94e-41 SMART
KR 377 459 6.59e-47 SMART
Tryp_SPc 488 709 2.27e-55 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159372
Predicted Effect probably benign
Transcript: ENSMUST00000160184
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162886
SMART Domains Protein: ENSMUSP00000125175
Gene: ENSMUSG00000032591

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 1.07e-46 SMART
KR 281 363 7.94e-41 SMART
KR 368 450 6.59e-47 SMART
Tryp_SPc 479 700 2.27e-55 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains four kringle domains and a serine protease domain, similar to that found in hepatic growth factor. Despite the presence of the serine protease domain, the encoded protein may not have any proteolytic activity. The receptor for this protein is RON tyrosine kinase, which upon activation stimulates ciliary motility of ciliated epithelial lung cells. This protein is secreted and cleaved to form an alpha chain and a beta chain bridged by disulfide bonds. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lipid-filled cytoplasmic vacuoles in hepatocytes throughout the liver lobules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Mst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Mst1 APN 9 108081601 missense probably benign 0.03
IGL01380:Mst1 APN 9 108084588 missense probably damaging 1.00
IGL01420:Mst1 APN 9 108082828 missense probably damaging 0.99
IGL02931:Mst1 APN 9 108084642 intron probably null
IGL03059:Mst1 APN 9 108084813 missense probably damaging 1.00
IGL03275:Mst1 APN 9 108084388 missense possibly damaging 0.70
R0319:Mst1 UTSW 9 108082513 missense probably benign 0.05
R0361:Mst1 UTSW 9 108084897 missense probably damaging 0.98
R0412:Mst1 UTSW 9 108083594 missense probably benign 0.06
R0569:Mst1 UTSW 9 108082301 missense probably damaging 0.98
R1432:Mst1 UTSW 9 108084204 missense probably benign 0.01
R1483:Mst1 UTSW 9 108081650 missense probably benign 0.03
R1859:Mst1 UTSW 9 108084346 missense probably benign 0.23
R2187:Mst1 UTSW 9 108084340 missense possibly damaging 0.63
R2393:Mst1 UTSW 9 108082952 critical splice donor site probably null
R3522:Mst1 UTSW 9 108081503 unclassified probably benign
R3916:Mst1 UTSW 9 108084295 missense probably benign 0.00
R3917:Mst1 UTSW 9 108084295 missense probably benign 0.00
R3945:Mst1 UTSW 9 108084853 missense probably damaging 1.00
R4006:Mst1 UTSW 9 108082948 missense possibly damaging 0.52
R4007:Mst1 UTSW 9 108082948 missense possibly damaging 0.52
R4737:Mst1 UTSW 9 108080521 missense probably benign 0.00
R4756:Mst1 UTSW 9 108083627 missense probably benign 0.28
R5047:Mst1 UTSW 9 108084309 missense probably benign 0.17
R5113:Mst1 UTSW 9 108082247 missense probably damaging 1.00
R5278:Mst1 UTSW 9 108082215 missense probably damaging 0.99
R5279:Mst1 UTSW 9 108082215 missense probably damaging 0.99
R5402:Mst1 UTSW 9 108084209 critical splice donor site probably null
R5677:Mst1 UTSW 9 108081286 missense probably damaging 0.98
R5712:Mst1 UTSW 9 108082908 missense probably damaging 1.00
R7059:Mst1 UTSW 9 108084064 missense probably benign 0.44
R7131:Mst1 UTSW 9 108084931 missense probably null 0.07
R7139:Mst1 UTSW 9 108082828 missense probably damaging 0.99
R7219:Mst1 UTSW 9 108081286 missense probably damaging 0.99
R7501:Mst1 UTSW 9 108082549 missense probably damaging 1.00
X0028:Mst1 UTSW 9 108082217 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTATGTGTCAGTCAAGTCCAGG -3'
(R):5'- GTTGAAAGACTGCCTCTGGG -3'

Sequencing Primer
(F):5'- TCAGTCAAGTCCAGGCAGGTTC -3'
(R):5'- CTGGGCTACAGTATGCTCTAATG -3'
Posted On2019-03-06