Incidental Mutation 'R6624:Sdccag8'
List |< first << previous [record 27 of 33] next >> last >|
ID543566
Institutional Source Beutler Lab
Gene Symbol Sdccag8
Ensembl Gene ENSMUSG00000026504
Gene Nameserologically defined colon cancer antigen 8
SynonymsCCCAP, 2700048G21Rik, 5730470G24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6624 (G1)
Quality Score76.0075
Status Validated
Chromosome1
Chromosomal Location176814660-177020437 bp(+) (GRCm38)
Type of Mutationintron (114 bp from exon)
DNA Base Change (assembly) T to A at 176874812 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027785] [ENSMUST00000123409]
Predicted Effect probably null
Transcript: ENSMUST00000027785
SMART Domains Protein: ENSMUSP00000027785
Gene: ENSMUSG00000026504

DomainStartEndE-ValueType
Pfam:CCCAP 6 710 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123409
SMART Domains Protein: ENSMUSP00000137948
Gene: ENSMUSG00000026504

DomainStartEndE-ValueType
low complexity region 92 105 N/A INTRINSIC
coiled coil region 132 168 N/A INTRINSIC
coiled coil region 228 278 N/A INTRINSIC
coiled coil region 307 327 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome associated protein. This protein may be involved in organizing the centrosome during interphase and mitosis. Mutations in this gene are associated with retinal-renal ciliopathy. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygotes for a null allele show postnatal lethality, cleft palate, polydactyly, enlarged lateral ventricles and impaired neuronal migration. Homozygotes for a gene trap allele show late-onset nephronophthisis associated with renal cysts and fibrosis, and retinal degeneration leading to blindness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Sdccag8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Sdccag8 APN 1 176878002 missense possibly damaging 0.67
IGL01446:Sdccag8 APN 1 176845245 missense probably damaging 1.00
IGL01794:Sdccag8 APN 1 176845307 missense possibly damaging 0.69
IGL02179:Sdccag8 APN 1 176878056 missense probably benign 0.19
IGL02313:Sdccag8 APN 1 176824755 missense possibly damaging 0.48
IGL02962:Sdccag8 APN 1 176948362 missense probably damaging 1.00
R0433:Sdccag8 UTSW 1 176844821 splice site probably null
R0762:Sdccag8 UTSW 1 176946144 missense probably benign 0.05
R1928:Sdccag8 UTSW 1 176828970 missense probably damaging 1.00
R2132:Sdccag8 UTSW 1 176955889 missense probably damaging 1.00
R2342:Sdccag8 UTSW 1 176919641 missense probably benign 0.26
R2964:Sdccag8 UTSW 1 176948371 missense possibly damaging 0.93
R3800:Sdccag8 UTSW 1 176868338 nonsense probably null
R3853:Sdccag8 UTSW 1 176853795 missense probably damaging 1.00
R4409:Sdccag8 UTSW 1 176868366 critical splice donor site probably null
R4590:Sdccag8 UTSW 1 176948292 missense probably damaging 1.00
R5036:Sdccag8 UTSW 1 177011975 missense probably damaging 0.99
R5083:Sdccag8 UTSW 1 176824892 missense probably damaging 1.00
R5174:Sdccag8 UTSW 1 176845350 missense probably damaging 0.99
R5739:Sdccag8 UTSW 1 176826231 missense probably benign 0.00
R5740:Sdccag8 UTSW 1 176831150 missense probably benign 0.02
R5898:Sdccag8 UTSW 1 176824822 missense probably benign 0.09
R6435:Sdccag8 UTSW 1 176814862 unclassified probably benign
R6763:Sdccag8 UTSW 1 176854627 intron probably null
R6877:Sdccag8 UTSW 1 177011935 missense probably damaging 1.00
R7130:Sdccag8 UTSW 1 176874601 missense probably damaging 0.97
R7331:Sdccag8 UTSW 1 176868290 missense possibly damaging 0.91
R7393:Sdccag8 UTSW 1 176840306 missense probably benign 0.00
X0024:Sdccag8 UTSW 1 176919629 missense probably damaging 1.00
Z1176:Sdccag8 UTSW 1 176868231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGGTTGAAAAGGTCACCAG -3'
(R):5'- TCCCGTGTGCCTGAATACAG -3'

Sequencing Primer
(F):5'- ACTGCAGCTGTCAGTCACTTAGAG -3'
(R):5'- TGTGCCTGAATACAGCACAC -3'
Posted On2019-03-08