Incidental Mutation 'R6747:Pcbp4'
ID543570
Institutional Source Beutler Lab
Gene Symbol Pcbp4
Ensembl Gene ENSMUSG00000023495
Gene Namepoly(rC) binding protein 4
Synonyms1200003L19Rik, AlphaCP-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.622) question?
Stock #R6747 (G1)
Quality Score178.009
Status Validated
Chromosome9
Chromosomal Location106453291-106464012 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 106460648 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024260] [ENSMUST00000185779] [ENSMUST00000185874] [ENSMUST00000190430] [ENSMUST00000214252] [ENSMUST00000215656] [ENSMUST00000216379]
Predicted Effect probably null
Transcript: ENSMUST00000024260
SMART Domains Protein: ENSMUSP00000024260
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
KH 16 84 4.15e-14 SMART
KH 100 171 1.47e-14 SMART
KH 240 310 3.24e-16 SMART
low complexity region 327 349 N/A INTRINSIC
low complexity region 364 381 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000185779
SMART Domains Protein: ENSMUSP00000140629
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
KH 16 84 2.6e-16 SMART
KH 100 171 9.3e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185874
SMART Domains Protein: ENSMUSP00000141057
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
KH 16 84 2.6e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190430
SMART Domains Protein: ENSMUSP00000140485
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
KH 16 84 2.6e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000214252
Predicted Effect probably benign
Transcript: ENSMUST00000215656
Predicted Effect probably null
Transcript: ENSMUST00000216379
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KH-domain protein subfamily. Proteins of this subfamily, also referred to as alpha-CPs, bind to RNA with a specificity for C-rich pyrimidine regions. Alpha-CPs play important roles in post-transcriptional activities and have different cellular distributions. This gene is induced by the p53 tumor suppressor, and the encoded protein can suppress cell proliferation by inducing apoptosis and cell cycle arrest in G(2)-M. This gene's protein is found in the cytoplasm, yet it lacks the nuclear localization signals found in other subfamily members. Multiple alternatively spliced transcript variants have been described, but the full-length nature for only some has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous or heterozygous for a knock-out allele are reduced in body weight and prone to lung adenocarcinoma, B cell derived lymphoma and lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 probably null Het
Acyp1 C T 12: 85,278,905 V107I probably null Het
Aftph T C 11: 20,726,144 probably null Het
Agtpbp1 A T 13: 59,544,353 probably null Het
Arhgap15 C A 2: 44,116,677 P269T probably damaging Het
Arhgap30 T C 1: 171,407,729 V557A probably damaging Het
Asb3 T A 11: 31,081,493 M410K probably benign Het
B4galnt2 T C 11: 95,868,634 probably null Het
Birc3 A G 9: 7,860,261 probably null Het
Cav2 A T 6: 17,286,951 N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 C826Y probably benign Het
Cenpf T A 1: 189,652,854 T2410S probably benign Het
Chchd1 A G 14: 20,703,380 D24G probably benign Het
Cmip G A 8: 117,436,879 G450S probably benign Het
Col11a1 C T 3: 114,212,450 Q534* probably null Het
Col3a1 G T 1: 45,338,622 probably benign Het
Cox4i1 T C 8: 120,673,230 I31T possibly damaging Het
Cstf3 G T 2: 104,646,767 V168F probably damaging Het
Dapk1 T C 13: 60,725,340 I352T probably benign Het
Ddx52 T C 11: 83,955,302 V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 T369A probably benign Het
Dppa1 T A 11: 46,625,595 I8F unknown Het
Ebf1 G T 11: 44,883,814 V213F probably damaging Het
Foxb2 C A 19: 16,872,833 E270* probably null Het
Gclc A T 9: 77,788,245 R450W probably damaging Het
Gm13128 T C 4: 144,332,978 W420R probably benign Het
Grin2d T C 7: 45,862,268 E251G probably damaging Het
Hal A T 10: 93,500,677 N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 I185F unknown Het
Lrp3 T A 7: 35,211,437 Q61L probably benign Het
Met A C 6: 17,571,467 Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 W16C probably benign Het
Myh13 G A 11: 67,350,419 R874Q probably damaging Het
Nelfb G A 2: 25,203,381 T453I probably benign Het
Nos2 A G 11: 78,952,954 D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 D149G probably benign Het
Olfr203 T C 16: 59,303,641 F164L probably benign Het
Olfr690 C T 7: 105,330,027 R55H probably benign Het
Peg10 A G 6: 4,757,137 probably benign Het
Pms2 C T 5: 143,925,419 P154L probably benign Het
Pou6f2 A C 13: 18,129,187 L112R probably benign Het
Prdm6 A T 18: 53,465,046 probably benign Het
Prob1 G A 18: 35,655,154 R12W probably damaging Het
Rif1 T A 2: 52,078,263 probably null Het
Rpl9-ps6 A G 19: 32,466,143 S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Homo
Sec23ip A G 7: 128,752,849 silent Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slc39a8 T C 3: 135,849,180 probably null Het
Slc6a18 C A 13: 73,677,991 probably benign Het
Snw1 T C 12: 87,464,710 D57G probably damaging Het
Sox6 C G 7: 115,541,731 R505P probably damaging Het
Speg T C 1: 75,410,395 probably null Het
Spire2 C T 8: 123,356,846 R190C probably damaging Het
Stard9 A C 2: 120,698,383 H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 T237K probably damaging Het
Themis2 T A 4: 132,796,262 E31V possibly damaging Het
Trim56 T G 5: 137,114,521 Q47P probably damaging Het
Trim58 T C 11: 58,651,264 I350T probably benign Het
Ttll7 C T 3: 146,944,056 P639S probably benign Het
Ubxn6 A G 17: 56,070,650 probably null Het
Vmn2r114 A T 17: 23,309,876 F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 M822L probably benign Het
Vps9d1 T C 8: 123,254,007 D27G probably damaging Het
Wdr3 C T 3: 100,138,724 R931Q probably damaging Het
Whamm G A 7: 81,578,302 probably null Het
Zcchc24 T C 14: 25,757,033 H142R probably damaging Het
Zfp292 T C 4: 34,806,894 K2050R probably damaging Het
Other mutations in Pcbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Pcbp4 APN 9 106463249 splice site probably null
IGL01484:Pcbp4 APN 9 106460649 critical splice acceptor site probably null
R1688:Pcbp4 UTSW 9 106461334 missense probably damaging 1.00
R2211:Pcbp4 UTSW 9 106460734 missense probably benign 0.28
R3894:Pcbp4 UTSW 9 106461371 missense possibly damaging 0.82
R4729:Pcbp4 UTSW 9 106460730 missense probably damaging 1.00
R4884:Pcbp4 UTSW 9 106462102 missense probably benign 0.03
R5007:Pcbp4 UTSW 9 106462093 missense probably damaging 1.00
R5112:Pcbp4 UTSW 9 106460718 missense probably damaging 1.00
R6050:Pcbp4 UTSW 9 106462223 missense probably benign 0.41
R8381:Pcbp4 UTSW 9 106461289 missense probably damaging 1.00
R8717:Pcbp4 UTSW 9 106460003 critical splice acceptor site probably null
X0027:Pcbp4 UTSW 9 106462583 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTAAAGCGAATCCGGG -3'
(R):5'- GTCAGGTTTCTCACAGGCAG -3'

Sequencing Primer
(F):5'- CCCTGATGCTGAGGGTAGG -3'
(R):5'- GTTTCTCACAGGCAGCCACC -3'
Posted On2019-03-08