Mutagenetix > Incidental Mutation

Incidental Mutation 'R6662:Catsperg2'

543577

Institutional Source

Beutler Lab

Gene Symbol

Catsperg2

Ensembl Gene

ENSMUSG00000049123

Gene Name

cation channel sperm associated auxiliary subunit gamma 2

Synonyms

1700067C01Rik, CATSPERG

MMRRC Submission

044782-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R6662 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

29697219-29727032 bp(-) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

G to A at 29719513 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061193] [ENSMUST00000207115] [ENSMUST00000208371] [ENSMUST00000208607] [ENSMUST00000209126]

AlphaFold

C6KI89

Predicted Effect

silent
Transcript: ENSMUST00000061193

SMART Domains

Protein: ENSMUSP00000052285
Gene: ENSMUSG00000049123

Domain	Start	End	E-Value	Type
Pfam:CATSPERG	2	973	N/A	PFAM
transmembrane domain	1065	1087	N/A	INTRINSIC
low complexity region	1106	1118	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000207115

Predicted Effect

probably benign
Transcript: ENSMUST00000208371

Predicted Effect

silent
Transcript: ENSMUST00000208607

Predicted Effect

silent
Transcript: ENSMUST00000209126

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (46/46)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	A	G	19: 57,073,853		probably null	Het
Acox1	A	G	11: 116,175,323	Y418H	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Aldh3a1	G	A	11: 61,214,655	V196I	probably benign	Het
Aox3	A	G	1: 58,118,615	K44E	probably damaging	Het
Bad	T	A	19: 6,951,070		probably benign	Het
BC034090	G	T	1: 155,226,339	Q60K	possibly damaging	Het
Casp6	A	G	3: 129,912,226	T181A	probably benign	Het
Ccdc14	T	C	16: 34,690,794	L46P	probably damaging	Het
Ces1b	A	G	8: 93,064,069	L364S	probably benign	Het
Cfap45	T	C	1: 172,529,850	I15T	probably benign	Het
D730048I06Rik	C	A	9: 35,790,000	R6M	possibly damaging	Het
Dph5	G	A	3: 115,928,556	E228K	probably benign	Het
Fat4	G	T	3: 38,956,821	L2023F	possibly damaging	Het
Garem1	T	C	18: 21,148,247	N351D	probably benign	Het
Gm14124	G	A	2: 150,266,252		probably null	Het
Grm2	C	T	9: 106,648,053	A488T	probably benign	Het
Ifit3b	A	G	19: 34,611,937	E171G	probably damaging	Het
Il1rn	A	T	2: 24,336,875		probably null	Het
Itih5	A	T	2: 10,249,181	I748F	probably benign	Het
Kcnh5	C	A	12: 75,007,611	D520Y	probably damaging	Het
Mgat5	C	A	1: 127,469,237	H574N	probably damaging	Het
Moxd1	A	C	10: 24,284,760	D437A	probably damaging	Het
Mybpc2	A	G	7: 44,506,166	F888L	probably benign	Het
Ncs1	T	A	2: 31,287,360	L183Q	probably damaging	Het
Neto2	A	T	8: 85,663,215	D206E	probably damaging	Het
Omp	A	G	7: 98,145,339	L27P	probably damaging	Het
Oxsm	A	G	14: 16,242,287	S161P	probably benign	Het
Pde4b	A	G	4: 102,601,898	I381M	possibly damaging	Het
Pramel5	A	T	4: 144,273,105	N137K	probably benign	Het
Prss33	T	C	17: 23,833,960	S247G	probably damaging	Het
Rassf9	T	A	10: 102,546,038	L425Q	possibly damaging	Het
Setx	A	T	2: 29,158,114	D1909V	probably damaging	Het
Slc26a3	A	T	12: 31,457,346	K402*	probably null	Het
Slco1a6	G	A	6: 142,133,215	T118I	probably damaging	Het
Syne1	A	G	10: 5,128,416	L6769P	probably damaging	Het
Tas2r107	A	T	6: 131,659,489	V199D	possibly damaging	Het
Tchp	A	G	5: 114,720,015		probably null	Het
Trdn	A	T	10: 33,474,487	N684I	probably damaging	Het
Trio	G	T	15: 27,854,996	T700K	probably benign	Het
Ttn	C	T	2: 76,755,898	V20084I	probably benign	Het
Ubl3	A	T	5: 148,509,306	Y62*	probably null	Het
Uckl1	A	G	2: 181,573,260	Y267H	possibly damaging	Het
Zfp786	T	C	6: 47,826,986	N41D	probably damaging	Het
Zfp983	T	C	17: 21,662,085	S310P	probably damaging	Het

Other mutations in Catsperg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Catsperg2	APN	7	29705404	missense	possibly damaging	0.86
IGL00095:Catsperg2	APN	7	29698058	missense	possibly damaging	0.73
IGL00902:Catsperg2	APN	7	29701143	missense	possibly damaging	0.93
IGL01667:Catsperg2	APN	7	29710133	missense	probably damaging	0.98
IGL01791:Catsperg2	APN	7	29704665	splice site	probably null
IGL01961:Catsperg2	APN	7	29721672	splice site	probably benign
IGL02187:Catsperg2	APN	7	29721366	missense	probably benign	0.02
IGL02605:Catsperg2	APN	7	29719565	missense	possibly damaging	0.71
IGL03001:Catsperg2	APN	7	29725079	missense	probably benign	0.32
IGL03228:Catsperg2	APN	7	29698225	missense	probably damaging	0.96
IGL03239:Catsperg2	APN	7	29697716	missense	probably benign	0.04
IGL03242:Catsperg2	APN	7	29725479	unclassified	probably benign
IGL03247:Catsperg2	APN	7	29717048	missense	possibly damaging	0.71
IGL03256:Catsperg2	APN	7	29709874	missense	probably damaging	0.99
PIT4520001:Catsperg2	UTSW	7	29710161	missense	possibly damaging	0.93
R0052:Catsperg2	UTSW	7	29725020	splice site	probably benign
R0281:Catsperg2	UTSW	7	29706571	missense	possibly damaging	0.86
R0357:Catsperg2	UTSW	7	29714901	missense	possibly damaging	0.93
R0480:Catsperg2	UTSW	7	29721298	missense	probably damaging	0.98
R0578:Catsperg2	UTSW	7	29704691	missense	possibly damaging	0.71
R0732:Catsperg2	UTSW	7	29700696	missense	probably damaging	1.00
R0826:Catsperg2	UTSW	7	29705624	missense	possibly damaging	0.92
R1535:Catsperg2	UTSW	7	29698246	missense	possibly damaging	0.85
R1925:Catsperg2	UTSW	7	29697764	missense	probably benign	0.01
R1990:Catsperg2	UTSW	7	29721045	nonsense	probably null
R3433:Catsperg2	UTSW	7	29701218	missense	possibly damaging	0.71
R3721:Catsperg2	UTSW	7	29705102	missense	probably benign	0.02
R4020:Catsperg2	UTSW	7	29717004	missense	probably damaging	0.99
R4760:Catsperg2	UTSW	7	29705635	missense	probably damaging	0.99
R4829:Catsperg2	UTSW	7	29701125	missense	probably damaging	0.98
R5033:Catsperg2	UTSW	7	29710134	missense	possibly damaging	0.93
R5093:Catsperg2	UTSW	7	29716998	missense	probably benign	0.32
R5266:Catsperg2	UTSW	7	29717066	missense	probably damaging	0.98
R5267:Catsperg2	UTSW	7	29717066	missense	probably damaging	0.98
R5287:Catsperg2	UTSW	7	29697838	missense	possibly damaging	0.96
R5427:Catsperg2	UTSW	7	29714850	missense	possibly damaging	0.71
R5575:Catsperg2	UTSW	7	29705590	missense	possibly damaging	0.84
R5685:Catsperg2	UTSW	7	29701188	missense	probably damaging	1.00
R5844:Catsperg2	UTSW	7	29697832	missense	possibly damaging	0.96
R5982:Catsperg2	UTSW	7	29713017	missense	possibly damaging	0.51
R6744:Catsperg2	UTSW	7	29709819	missense	probably benign	0.23
R7171:Catsperg2	UTSW	7	29705325	missense	possibly damaging	0.71
R7239:Catsperg2	UTSW	7	29710082	missense	probably benign	0.00
R7336:Catsperg2	UTSW	7	29706601	missense	possibly damaging	0.83
R7498:Catsperg2	UTSW	7	29717102	missense	possibly damaging	0.71
R7548:Catsperg2	UTSW	7	29709826	missense	probably benign	0.32
R7562:Catsperg2	UTSW	7	29697719	missense	probably benign	0.18
R7565:Catsperg2	UTSW	7	29712981	missense	probably null	0.71
R7600:Catsperg2	UTSW	7	29704858	missense	probably benign	0.32
R8460:Catsperg2	UTSW	7	29705319	missense	possibly damaging	0.92
R8461:Catsperg2	UTSW	7	29705319	missense	possibly damaging	0.92
R8751:Catsperg2	UTSW	7	29705319	missense	possibly damaging	0.92
R8752:Catsperg2	UTSW	7	29705319	missense	possibly damaging	0.92
R8829:Catsperg2	UTSW	7	29697844	missense	probably benign	0.33
R8832:Catsperg2	UTSW	7	29697844	missense	probably benign	0.33
R9264:Catsperg2	UTSW	7	29698188	missense	possibly damaging	0.72
R9284:Catsperg2	UTSW	7	29705581	critical splice donor site	probably null
R9468:Catsperg2	UTSW	7	29710007	critical splice donor site	probably null
Z1177:Catsperg2	UTSW	7	29697782	missense	possibly damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CCCATTCTGTAGTCCCAGAC -3'
(R):5'- TCCCTGGAGTGAGCTGAATG -3'

Sequencing Primer
(F):5'- GTAGTCCCAGACCCCCTTCAG -3'
(R):5'- CCCTGGAGTGAGCTGAATGTAAGG -3'

Posted On

2019-03-13