Incidental Mutation 'R6637:Fign'
ID543579
Institutional Source Beutler Lab
Gene Symbol Fign
Ensembl Gene ENSMUSG00000075324
Gene Namefidgetin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6637 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location63971507-64098038 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 64027908 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102728] [ENSMUST00000131615]
Predicted Effect probably benign
Transcript: ENSMUST00000102728
Predicted Effect probably benign
Transcript: ENSMUST00000131615
SMART Domains Protein: ENSMUSP00000122855
Gene: ENSMUSG00000075324

DomainStartEndE-ValueType
low complexity region 204 235 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 259 291 N/A INTRINSIC
AAA 518 654 7.03e-12 SMART
Pfam:Vps4_C 708 756 2.1e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.1%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Homozygotes for a reporter allele show pre- and postnatal death, head-shaking, and small eyes. Spontaneous mutants show head-shaking, circling, reduced or absent semicircular canals, small abnormal eyes, aberrant cell-cycling, female sterility, and low prenetrance craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Adh1 T A 3: 138,282,470 C98* probably null Het
Alms1 A G 6: 85,619,734 H514R possibly damaging Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
Cdh3 G C 8: 106,511,341 V56L probably benign Het
Col3a1 C T 1: 45,347,730 T234I probably damaging Het
Cxadr C T 16: 78,333,503 T186M possibly damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fbxo16 A G 14: 65,295,761 probably null Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Invs G A 4: 48,416,203 probably null Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Kcnk5 A C 14: 20,144,721 M183R probably null Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Lrrc8b A C 5: 105,480,271 D161A possibly damaging Het
Lrriq1 A T 10: 103,221,432 F169Y probably benign Het
Lsamp T A 16: 41,533,381 V2D possibly damaging Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Olfr1095 T G 2: 86,851,440 K86T probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Spa17 A T 9: 37,611,974 S6T probably benign Het
Ston2 G C 12: 91,714,112 T126S probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tbr1 A G 2: 61,811,630 D150G probably benign Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Ubxn4 C A 1: 128,277,087 Q505K probably damaging Het
Vcl A G 14: 21,003,132 E405G probably damaging Het
Vmn2r26 A T 6: 124,061,691 I742F probably damaging Het
Other mutations in Fign
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Fign APN 2 63979010 missense probably damaging 0.99
IGL01149:Fign APN 2 63979760 missense possibly damaging 0.92
IGL01328:Fign APN 2 63978872 missense probably damaging 0.97
IGL01448:Fign APN 2 63979688 missense probably damaging 0.97
IGL01680:Fign APN 2 63978644 utr 3 prime probably benign
IGL01989:Fign APN 2 63980450 missense probably benign
IGL02010:Fign APN 2 63980400 missense probably damaging 0.98
IGL02092:Fign APN 2 63980583 missense possibly damaging 0.95
IGL02252:Fign APN 2 63980639 missense probably benign 0.14
IGL02455:Fign APN 2 63980497 missense probably benign 0.22
IGL02541:Fign APN 2 63979537 missense probably benign 0.38
IGL03109:Fign APN 2 63980662 missense possibly damaging 0.83
R0534:Fign UTSW 2 63980791 missense probably damaging 0.96
R0630:Fign UTSW 2 63980141 missense possibly damaging 0.86
R1678:Fign UTSW 2 63980374 missense probably damaging 0.99
R2512:Fign UTSW 2 63979799 missense probably benign 0.03
R3125:Fign UTSW 2 63978700 missense possibly damaging 0.94
R4679:Fign UTSW 2 63979261 missense probably damaging 1.00
R4735:Fign UTSW 2 63980438 missense probably damaging 1.00
R4753:Fign UTSW 2 63979019 missense probably benign 0.04
R5071:Fign UTSW 2 63979693 nonsense probably null
R5072:Fign UTSW 2 63979693 nonsense probably null
R5073:Fign UTSW 2 63979693 nonsense probably null
R5074:Fign UTSW 2 63979693 nonsense probably null
R5344:Fign UTSW 2 63979225 missense probably benign 0.01
R5427:Fign UTSW 2 63978998 missense probably damaging 1.00
R5922:Fign UTSW 2 63979060 missense probably damaging 0.99
R6115:Fign UTSW 2 63979310 missense probably benign 0.22
R6373:Fign UTSW 2 63979645 missense probably benign 0.06
R6542:Fign UTSW 2 63980295 missense possibly damaging 0.53
R6858:Fign UTSW 2 63979813 missense probably benign 0.02
R7188:Fign UTSW 2 63979606 missense possibly damaging 0.95
R7309:Fign UTSW 2 63979957 missense possibly damaging 0.77
R7429:Fign UTSW 2 63979060 missense probably damaging 0.99
R7430:Fign UTSW 2 63979060 missense probably damaging 0.99
R7608:Fign UTSW 2 63978719 missense possibly damaging 0.75
R7642:Fign UTSW 2 63980572 missense probably benign 0.16
R7782:Fign UTSW 2 63979162 missense probably damaging 1.00
R8775:Fign UTSW 2 63980547 missense probably benign 0.32
R8775-TAIL:Fign UTSW 2 63980547 missense probably benign 0.32
R8939:Fign UTSW 2 63979112 missense probably benign 0.37
X0028:Fign UTSW 2 63980851 missense probably damaging 1.00
Z1088:Fign UTSW 2 64096902 missense probably benign 0.01
Z1177:Fign UTSW 2 63979385 missense probably damaging 1.00
Z1177:Fign UTSW 2 63979690 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAACTGTCTCCTCTAATTGCCG -3'
(R):5'- TCCACTAACTGTTCTATGGGTTG -3'

Sequencing Primer
(F):5'- TCCTCTAATTGCCGAAAGTTACACG -3'
(R):5'- GGGTTGTTTTATCATAAATTCAGCC -3'
Posted On2019-03-13