Incidental Mutation 'R0607:Pcdhac2'
ID54358
Institutional Source Beutler Lab
Gene Symbol Pcdhac2
Ensembl Gene ENSMUSG00000102697
Gene Nameprotocadherin alpha subfamily C, 2
SynonymsCNRc2
MMRRC Submission 038796-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0607 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37143503-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37145889 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 641 (I641V)
Ref Sequence ENSEMBL: ENSMUSP00000039888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007584] [ENSMUST00000047479] [ENSMUST00000047614] [ENSMUST00000070797] [ENSMUST00000115657] [ENSMUST00000115658] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192447] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000193839] [ENSMUST00000194038] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000007584
SMART Domains Protein: ENSMUSP00000007584
Gene: ENSMUSG00000103255

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 45 122 3.59e-1 SMART
CA 146 231 6.32e-22 SMART
CA 255 338 5.18e-18 SMART
CA 362 443 9.73e-23 SMART
CA 467 554 4.24e-23 SMART
CA 584 662 1.11e-8 SMART
Pfam:Cadherin_C_2 682 773 1.1e-12 PFAM
Pfam:Cadherin_tail 813 947 5.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047479
AA Change: I641V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000039888
Gene: ENSMUSG00000102697
AA Change: I641V

DomainStartEndE-ValueType
CA 30 145 9.8e-3 SMART
CA 169 254 2.07e-17 SMART
CA 278 362 2.86e-29 SMART
CA 386 466 4.79e-22 SMART
CA 490 576 1.44e-25 SMART
CA 606 687 3.45e-14 SMART
Pfam:Cadherin_C_2 702 809 1.2e-26 PFAM
low complexity region 810 823 N/A INTRINSIC
Pfam:Cadherin_tail 855 989 5.8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047614
SMART Domains Protein: ENSMUSP00000047609
Gene: ENSMUSG00000103310

DomainStartEndE-ValueType
CA 19 131 3.78e-2 SMART
CA 155 240 3.26e-24 SMART
CA 264 348 6.37e-27 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 6.18e-25 SMART
CA 594 676 5.6e-14 SMART
low complexity region 679 696 N/A INTRINSIC
transmembrane domain 699 721 N/A INTRINSIC
Pfam:Cadherin_tail 799 933 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115657
SMART Domains Protein: ENSMUSP00000111321
Gene: ENSMUSG00000102206

DomainStartEndE-ValueType
CA 21 131 2.95e-2 SMART
CA 155 240 7.44e-19 SMART
CA 264 347 5.63e-28 SMART
CA 371 452 3.14e-26 SMART
CA 476 562 1.42e-24 SMART
CA 593 675 1.03e-12 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
low complexity region 918 942 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115658
SMART Domains Protein: ENSMUSP00000111322
Gene: ENSMUSG00000007440

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
CA 46 132 6.34e-2 SMART
CA 156 241 4.65e-20 SMART
CA 265 349 1.25e-25 SMART
CA 373 454 9.22e-24 SMART
CA 478 564 4.3e-24 SMART
CA 595 678 5.07e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 795 929 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115659
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192447
SMART Domains Protein: ENSMUSP00000142270
Gene: ENSMUSG00000102206

DomainStartEndE-ValueType
CA 21 131 1.5e-4 SMART
CA 155 240 3.6e-21 SMART
CA 264 347 2.8e-30 SMART
CA 371 452 1.5e-28 SMART
CA 476 562 6.8e-27 SMART
CA 593 675 4.9e-15 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193856
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194038
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194691
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are viable and fertile with no apparent gross phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 147 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,554,698 E146G probably benign Het
4930435E12Rik A C 16: 38,828,364 S128A probably benign Het
Abca4 G A 3: 122,156,432 G594S probably damaging Het
Acacb T C 5: 114,200,301 Y726H probably damaging Het
Adam20 T A 8: 40,795,480 M209K probably benign Het
Adam29 A G 8: 55,873,275 V48A probably damaging Het
Adss A G 1: 177,767,687 V429A possibly damaging Het
Aff1 T C 5: 103,828,454 S481P probably damaging Het
Akr1c19 G A 13: 4,238,460 A146T probably benign Het
Ankhd1 G T 18: 36,640,280 V59F probably damaging Het
Ankmy1 T G 1: 92,888,675 Y239S probably damaging Het
Ankrd24 G T 10: 81,638,308 C19F probably damaging Het
Apaf1 T C 10: 91,009,203 H1002R probably damaging Het
Apc2 T C 10: 80,314,101 I1663T probably benign Het
Apcdd1 A G 18: 62,951,896 N388S possibly damaging Het
Arap2 G A 5: 62,606,131 P1557S possibly damaging Het
Armc2 T A 10: 41,922,695 H706L probably benign Het
Arrb1 T C 7: 99,588,196 probably null Het
Atl3 T C 19: 7,529,666 probably null Het
B9d2 A G 7: 25,683,332 T44A probably damaging Het
Btbd3 C T 2: 138,283,816 R307W possibly damaging Het
C1galt1 T C 6: 7,871,193 I343T probably benign Het
Cacna1a A G 8: 84,629,831 D1901G probably damaging Het
Ccdc42 C T 11: 68,597,710 Q312* probably null Het
Cdh18 T C 15: 23,410,790 Y454H probably benign Het
Celf5 G A 10: 81,466,005 T317I probably damaging Het
Celsr2 A T 3: 108,403,895 probably null Het
Cenpf A T 1: 189,682,463 probably null Het
Cep350 T C 1: 155,872,048 D2042G probably damaging Het
Chd3 T C 11: 69,344,358 D2054G probably damaging Het
Chgb A G 2: 132,793,335 H399R probably benign Het
Clp1 C T 2: 84,725,591 A182T possibly damaging Het
Col15a1 A G 4: 47,282,654 N777S probably damaging Het
Coq6 A G 12: 84,368,638 D145G possibly damaging Het
Csf2rb2 T C 15: 78,287,908 Y325C probably benign Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cyp4x1 T A 4: 115,112,826 D368V probably damaging Het
D10Wsu102e T C 10: 83,362,097 S56P probably benign Het
D430041D05Rik C T 2: 104,233,445 R1354H probably damaging Het
D6Ertd527e A C 6: 87,111,905 D350A unknown Het
Ddx24 A G 12: 103,419,067 Y426H possibly damaging Het
Dexi G T 16: 10,542,562 Y43* probably null Het
Dgka A G 10: 128,720,469 probably null Het
Dhx38 A T 8: 109,558,943 D419E probably benign Het
Dlg1 C A 16: 31,665,580 Q9K probably benign Het
Dlg1 G A 16: 31,838,174 V596I possibly damaging Het
Dnah11 A C 12: 118,082,511 W1731G probably damaging Het
Dnhd1 T A 7: 105,720,788 N4473K probably benign Het
Dync2h1 A C 9: 7,051,480 S3152A probably benign Het
Egfl7 C T 2: 26,589,440 T68I probably damaging Het
Eif2a G A 3: 58,555,652 probably null Het
Emb G A 13: 117,232,750 V56I possibly damaging Het
Enpp4 A T 17: 44,099,495 C397S probably damaging Het
Entpd3 A G 9: 120,557,405 T151A possibly damaging Het
Ero1lb A G 13: 12,574,866 D50G probably damaging Het
Fam219a A G 4: 41,520,242 *169Q probably null Het
Fga G A 3: 83,028,562 G32E probably damaging Het
Fkbpl T C 17: 34,645,359 F34L probably benign Het
Fsd2 T A 7: 81,545,017 D466V probably damaging Het
Gja1 A G 10: 56,388,070 Y175C possibly damaging Het
Gm5478 T A 15: 101,644,624 I338F probably damaging Het
Greb1 T A 12: 16,682,193 Y1589F probably damaging Het
Grk3 C T 5: 112,920,053 E537K probably damaging Het
H2-K1 G T 17: 33,999,500 D127E probably damaging Het
Hcrtr2 A G 9: 76,230,684 L383P probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ikbke A T 1: 131,270,184 probably null Het
Il1r2 A G 1: 40,105,455 K101E probably benign Het
Itga11 A T 9: 62,774,371 H1054L probably benign Het
Kif13a A T 13: 46,802,711 V539D probably damaging Het
Kifc1 G A 17: 33,886,647 T62I probably damaging Het
Klhl28 A G 12: 64,951,755 Y322H probably damaging Het
Klhl6 C A 16: 19,957,014 D265Y possibly damaging Het
Krt86 T A 15: 101,479,531 C479S unknown Het
Lama2 C T 10: 27,189,131 R1179H probably benign Het
Lce6a A T 3: 92,620,328 H57Q probably benign Het
Lcn11 T C 2: 25,779,293 V154A probably benign Het
Lnpep A T 17: 17,538,554 F843I probably damaging Het
Lrrc49 C T 9: 60,666,357 V281I probably benign Het
Lrrtm1 C A 6: 77,244,628 A356E probably damaging Het
Map3k1 A C 13: 111,763,510 H493Q probably benign Het
Mcm4 A T 16: 15,632,115 probably null Het
Mdn1 C T 4: 32,712,014 P1844L probably damaging Het
Mdn1 T A 4: 32,732,829 D3076E probably benign Het
Med6 A T 12: 81,589,024 L27H probably damaging Het
Mkl2 A G 16: 13,381,601 E106G probably damaging Het
Myo7a T A 7: 98,071,946 T1271S probably damaging Het
Myo9a T A 9: 59,921,793 M2376K probably benign Het
Nell2 G A 15: 95,229,214 T760I probably benign Het
Neurod6 C T 6: 55,679,587 A22T probably benign Het
Nlrp10 T C 7: 108,924,285 K663E probably benign Het
Npr3 T A 15: 11,845,282 K501N probably benign Het
Nr2f2 C A 7: 70,354,712 R264L probably damaging Het
Nup35 T A 2: 80,642,640 M19K probably benign Het
Oacyl A T 18: 65,747,891 Q592L possibly damaging Het
Olfr1061 T A 2: 86,413,170 N294I probably damaging Het
Olfr1243 A G 2: 89,528,107 V101A possibly damaging Het
Olfr1378 C A 11: 50,969,843 A275D possibly damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1484 T A 19: 13,586,170 Y289N probably damaging Het
Olfr17 T A 7: 107,097,726 I87K probably benign Het
Olfr312 T A 11: 58,831,972 S273T probably damaging Het
Olfr470 A G 7: 107,845,569 S55P probably damaging Het
Olfr56 C G 11: 49,134,722 H177D probably damaging Het
Olfr813 T G 10: 129,857,201 S228A possibly damaging Het
Olfr827 T C 10: 130,211,070 E20G probably benign Het
Patl2 T C 2: 122,126,669 Y128C probably benign Het
Polr2b T C 5: 77,313,159 probably benign Het
Pot1b A T 17: 55,665,765 I469N probably damaging Het
Prdm11 G T 2: 93,013,785 D33E possibly damaging Het
Prkdc A G 16: 15,772,057 S2595G probably damaging Het
Prrc1 G A 18: 57,374,550 V259I possibly damaging Het
Prrc2b G T 2: 32,213,870 R1120L probably damaging Het
Prss38 T C 11: 59,375,543 S30G possibly damaging Het
Raph1 A T 1: 60,525,869 L153Q probably damaging Het
Reck A G 4: 43,940,719 T843A probably benign Het
Rgs7bp T C 13: 104,967,102 N164D probably benign Het
Rpusd4 C A 9: 35,267,993 A35D possibly damaging Het
Setd1b T C 5: 123,159,951 probably benign Het
Siglec15 G T 18: 78,046,137 D297E probably benign Het
Skint7 T A 4: 111,977,459 C13* probably null Het
Slc5a12 A G 2: 110,632,743 M395V probably benign Het
Sohlh2 C A 3: 55,207,683 S363Y probably damaging Het
Srgap3 A T 6: 112,723,119 V966E probably damaging Het
Stk4 C T 2: 164,098,542 P266L probably damaging Het
Stxbp5l G A 16: 37,142,432 H754Y probably benign Het
Synpo2l A T 14: 20,660,680 M624K probably damaging Het
Tas2r136 T C 6: 132,777,412 I251V probably benign Het
Tecpr1 C T 5: 144,212,590 V340M probably damaging Het
Tecta C T 9: 42,388,205 G196S probably damaging Het
Thsd7a T A 6: 12,331,542 probably null Het
Timeless T C 10: 128,246,334 V577A probably benign Het
Tln1 A T 4: 43,553,071 V340E probably damaging Het
Tmem132c T A 5: 127,563,553 Y929* probably null Het
Tmprss7 C T 16: 45,669,551 R436Q probably damaging Het
Tnik A C 3: 28,650,159 K989T probably damaging Het
Tnxb T A 17: 34,671,918 Y412N probably damaging Het
Trmt44 A G 5: 35,568,759 probably null Het
Trpm6 C A 19: 18,872,221 T1704N probably benign Het
Tsc2 A T 17: 24,621,712 V391E probably damaging Het
Ttc22 T C 4: 106,639,313 V520A possibly damaging Het
Ttc3 T A 16: 94,456,785 Y1650* probably null Het
Vmn2r24 A G 6: 123,786,934 T257A probably benign Het
Xab2 A C 8: 3,613,605 N408K probably benign Het
Zbtb42 A T 12: 112,680,627 Y412F probably benign Het
Zfp282 A G 6: 47,880,369 N179D probably damaging Het
Zfp62 C A 11: 49,215,400 T106K probably benign Het
Other mutations in Pcdhac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Pcdhac2 APN 18 37145075 missense probably damaging 1.00
IGL01400:Pcdhac2 APN 18 37146286 missense possibly damaging 0.79
IGL02302:Pcdhac2 APN 18 37145953 missense probably damaging 0.99
IGL02381:Pcdhac2 APN 18 37144267 missense possibly damaging 0.94
IGL02644:Pcdhac2 APN 18 37145179 missense probably benign
IGL02645:Pcdhac2 APN 18 37145239 missense probably damaging 0.97
IGL03087:Pcdhac2 APN 18 37145682 missense probably damaging 1.00
R0004:Pcdhac2 UTSW 18 37145237 missense probably benign 0.21
R0374:Pcdhac2 UTSW 18 37145667 missense probably damaging 1.00
R0540:Pcdhac2 UTSW 18 37145889 missense probably benign 0.02
R0589:Pcdhac2 UTSW 18 37146474 missense probably benign
R1537:Pcdhac2 UTSW 18 37146486 missense possibly damaging 0.51
R1545:Pcdhac2 UTSW 18 37146133 missense possibly damaging 0.93
R1878:Pcdhac2 UTSW 18 37145162 missense possibly damaging 0.71
R2139:Pcdhac2 UTSW 18 37146086 nonsense probably null
R2197:Pcdhac2 UTSW 18 37146132 missense probably damaging 0.99
R2680:Pcdhac2 UTSW 18 37145586 missense possibly damaging 0.82
R2882:Pcdhac2 UTSW 18 37145812 missense probably damaging 1.00
R3719:Pcdhac2 UTSW 18 37146235 missense possibly damaging 0.59
R4256:Pcdhac2 UTSW 18 37144711 missense probably damaging 1.00
R4407:Pcdhac2 UTSW 18 37144446 missense probably benign 0.00
R4426:Pcdhac2 UTSW 18 37144743 missense probably benign 0.00
R4698:Pcdhac2 UTSW 18 37145769 missense probably damaging 1.00
R4737:Pcdhac2 UTSW 18 37145899 missense possibly damaging 0.95
R4950:Pcdhac2 UTSW 18 37145230 missense probably benign 0.06
R4993:Pcdhac2 UTSW 18 37146251 missense probably damaging 0.96
R5127:Pcdhac2 UTSW 18 37144299 nonsense probably null
R5446:Pcdhac2 UTSW 18 37145200 missense probably damaging 1.00
R5598:Pcdhac2 UTSW 18 37144423 missense probably damaging 1.00
R5615:Pcdhac2 UTSW 18 37146423 missense probably benign 0.22
R5615:Pcdhac2 UTSW 18 37146424 missense probably benign
R5620:Pcdhac2 UTSW 18 37144204 missense probably benign
R5661:Pcdhac2 UTSW 18 37145446 missense probably damaging 0.97
R5760:Pcdhac2 UTSW 18 37146400 missense probably damaging 1.00
R6102:Pcdhac2 UTSW 18 37146282 nonsense probably null
R6310:Pcdhac2 UTSW 18 37145771 nonsense probably null
R6493:Pcdhac2 UTSW 18 37144705 missense probably damaging 1.00
R6695:Pcdhac2 UTSW 18 37145203 missense probably benign 0.00
R6827:Pcdhac2 UTSW 18 37144653 missense probably benign 0.03
R6953:Pcdhac2 UTSW 18 37144426 missense probably benign
R7140:Pcdhac2 UTSW 18 37144186 missense possibly damaging 0.89
R7162:Pcdhac2 UTSW 18 37145787 missense probably benign 0.13
R7242:Pcdhac2 UTSW 18 37144893 missense possibly damaging 0.82
R7325:Pcdhac2 UTSW 18 37145360 missense probably damaging 1.00
R7640:Pcdhac2 UTSW 18 37144525 missense probably damaging 1.00
R7654:Pcdhac2 UTSW 18 37145023 missense probably damaging 1.00
R7810:Pcdhac2 UTSW 18 37145664 missense probably benign 0.18
T0970:Pcdhac2 UTSW 18 37145335 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TGTCTCCATTAACAGTGCCAGCGG -3'
(R):5'- GTGCCATAAGCAGTGTAGCGGTAG -3'

Sequencing Primer
(F):5'- TAAGCAGCACTGTGACCG -3'
(R):5'- CGGTAGCACTTAATGATGCTCAG -3'
Posted On2013-07-11