Incidental Mutation 'R6739:Ctbs'
ID543584
Institutional Source Beutler Lab
Gene Symbol Ctbs
Ensembl Gene ENSMUSG00000028189
Gene Namechitobiase, di-N-acetyl-
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6739 (G1)
Quality Score117.008
Status Validated
Chromosome3
Chromosomal Location146449795-146465849 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 146459499 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000059167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029839] [ENSMUST00000029840] [ENSMUST00000061937] [ENSMUST00000197980]
Predicted Effect probably benign
Transcript: ENSMUST00000029839
SMART Domains Protein: ENSMUSP00000029839
Gene: ENSMUSG00000028188

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:SPATA1_C 279 428 1.7e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029840
SMART Domains Protein: ENSMUSP00000029840
Gene: ENSMUSG00000028189

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:Glyco_hydro_18 79 257 1.6e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000061937
SMART Domains Protein: ENSMUSP00000059167
Gene: ENSMUSG00000028189

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Glyco_18 45 343 2.62e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197980
SMART Domains Protein: ENSMUSP00000142800
Gene: ENSMUSG00000028188

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
SCOP:d1eq1a_ 267 365 8e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200488
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chitobiase is a lysosomal glycosidase involved in degradation of asparagine-linked oligosaccharides on glycoproteins (Aronson and Kuranda, 1989 [PubMed 2531691]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of oligosaccharides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C T 19: 7,421,347 R243* probably null Het
Adcy9 A G 16: 4,418,794 V14A probably benign Het
Ank2 A T 3: 127,079,994 N59K probably damaging Het
Ano4 T C 10: 89,027,252 Y286C probably damaging Het
Arhgap21 G A 2: 20,880,732 H545Y possibly damaging Het
Arid1a T A 4: 133,687,626 S1152C unknown Het
Cfap73 T C 5: 120,630,193 T167A probably benign Het
Dmgdh T A 13: 93,720,615 N742K probably benign Het
Dmxl1 T C 18: 49,878,246 S1157P probably benign Het
Dnm3 T C 1: 162,477,783 N14S probably damaging Het
Dpp4 C T 2: 62,387,095 V53I probably benign Het
Etl4 A G 2: 20,713,435 N329S probably damaging Het
Fbxw25 A G 9: 109,651,631 V327A probably benign Het
Gsg1 T A 6: 135,237,614 Q299L probably damaging Het
Igsf23 A G 7: 19,944,748 L39P probably damaging Het
Il17rd A G 14: 27,099,531 R261G possibly damaging Het
Krt75 C T 15: 101,571,068 D276N probably benign Het
Lox T C 18: 52,526,959 T268A possibly damaging Het
Mroh4 T C 15: 74,609,719 S825G probably benign Het
Nlrp9c T C 7: 26,385,425 D243G probably damaging Het
Olfr1375 T A 11: 51,048,737 V210E probably damaging Het
Olfr713 T C 7: 107,036,811 Y219H probably damaging Het
Picalm C A 7: 90,176,708 T131N probably damaging Het
Pitpnm1 T A 19: 4,110,522 L781H probably damaging Het
Proz A T 8: 13,073,451 I241F possibly damaging Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Rnf213 T A 11: 119,442,271 C2769S probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scn8a T C 15: 101,015,955 I1076T possibly damaging Het
Snrnp70 A T 7: 45,387,419 D100E probably damaging Het
Triobp T A 15: 78,966,366 L240Q possibly damaging Het
Vmn2r5 A G 3: 64,491,216 S781P probably damaging Het
Zfp451 A G 1: 33,803,594 probably benign Het
Other mutations in Ctbs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Ctbs APN 3 146455112 missense probably benign 0.02
R0133:Ctbs UTSW 3 146457468 missense probably benign 0.01
R0845:Ctbs UTSW 3 146455107 missense probably damaging 1.00
R1512:Ctbs UTSW 3 146454965 missense probably benign 0.00
R1523:Ctbs UTSW 3 146454980 missense probably benign 0.01
R4194:Ctbs UTSW 3 146450613 missense probably benign 0.00
R6607:Ctbs UTSW 3 146457373 missense possibly damaging 0.60
R7021:Ctbs UTSW 3 146454948 missense probably damaging 1.00
R7361:Ctbs UTSW 3 146458754 missense probably damaging 1.00
R7446:Ctbs UTSW 3 146458818 missense probably damaging 1.00
R8515:Ctbs UTSW 3 146458813 nonsense probably null
R8766:Ctbs UTSW 3 146459833 missense possibly damaging 0.90
R8915:Ctbs UTSW 3 146463969 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGGCAGTTTCTGAATGCC -3'
(R):5'- GGAATTCAAACATTTGCGTGTC -3'

Sequencing Primer
(F):5'- GGGCATCAGATCCCATTACAGATG -3'
(R):5'- TGCGTGTCATTATTGAGCAAATG -3'
Posted On2019-03-13