Incidental Mutation 'R6774:Mob4'
ID543585
Institutional Source Beutler Lab
Gene Symbol Mob4
Ensembl Gene ENSMUSG00000025979
Gene NameMOB family member 4, phocein
SynonymsMobkl3, Prei3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location55131231-55154899 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 55148429 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027122] [ENSMUST00000159311] [ENSMUST00000161122] [ENSMUST00000162364] [ENSMUST00000162553]
Predicted Effect probably null
Transcript: ENSMUST00000027122
SMART Domains Protein: ENSMUSP00000027122
Gene: ENSMUSG00000025979

DomainStartEndE-ValueType
Pfam:Mob1_phocein 28 168 1.2e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159311
SMART Domains Protein: ENSMUSP00000124790
Gene: ENSMUSG00000025979

DomainStartEndE-ValueType
Pfam:Mob1_phocein 19 189 9.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161122
Predicted Effect probably benign
Transcript: ENSMUST00000162364
SMART Domains Protein: ENSMUSP00000125415
Gene: ENSMUSG00000025979

DomainStartEndE-ValueType
Mob1_phocein 42 209 1.89e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162553
SMART Domains Protein: ENSMUSP00000124151
Gene: ENSMUSG00000025979

DomainStartEndE-ValueType
Pfam:Mob1_phocein 8 178 3.9e-63 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on its similarity with the mouse counterpart. Studies of the mouse counterpart suggest that the expression of this gene may be regulated during oocyte maturation and preimplantation following zygotic gene activation. Alternatively spliced transcript variants encoding distinct isoforms have been observed. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HSPE1.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Mob4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03340:Mob4 APN 1 55136708 missense possibly damaging 0.50
R4756:Mob4 UTSW 1 55152696 missense probably damaging 0.98
R4831:Mob4 UTSW 1 55152740 missense probably benign 0.01
R4832:Mob4 UTSW 1 55145252 intron probably benign
R4876:Mob4 UTSW 1 55152836 unclassified probably benign
R4972:Mob4 UTSW 1 55151002 missense possibly damaging 0.96
R5747:Mob4 UTSW 1 55148578 missense probably damaging 1.00
R6717:Mob4 UTSW 1 55136713 missense possibly damaging 0.91
R6925:Mob4 UTSW 1 55152722 nonsense probably null
R7447:Mob4 UTSW 1 55131466 start gained probably benign
R7721:Mob4 UTSW 1 55148320 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTATAAAAGGATAACCAGCTTGACC -3'
(R):5'- CTCACCTCTTTTGGAGTTTTATGAG -3'

Sequencing Primer
(F):5'- GGCAATTCTGCCTTGAACT -3'
(R):5'- TGGAGTTTTATGAGCTGCACAAAG -3'
Posted On2019-03-13