Incidental Mutation 'R6727:Tgfb1'
ID543587
Institutional Source Beutler Lab
Gene Symbol Tgfb1
Ensembl Gene ENSMUSG00000002603
Gene Nametransforming growth factor, beta 1
SynonymsTgfb, TGF-beta 1, TGFbeta1, Tgfb-1, TGF-beta1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.817) question?
Stock #R6727 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location25687002-25705077 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 25689162 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002678] [ENSMUST00000108403] [ENSMUST00000169009] [ENSMUST00000205658]
Predicted Effect probably benign
Transcript: ENSMUST00000002678
SMART Domains Protein: ENSMUSP00000002678
Gene: ENSMUSG00000002603

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:TGFb_propeptide 29 261 3.2e-41 PFAM
TGFB 293 390 1.95e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108403
SMART Domains Protein: ENSMUSP00000104040
Gene: ENSMUSG00000063439

DomainStartEndE-ValueType
Pfam:B9-C2 4 164 5.1e-64 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000169009
AA Change: Q41L
Predicted Effect probably benign
Transcript: ENSMUST00000205658
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. This encoded protein regulates cell proliferation, differentiation and growth, and can modulate expression and activation of other growth factors including interferon gamma and tumor necrosis factor alpha. Mice lacking a functional copy of this gene develop severe multifocal inflammatory disease, yolk sac defects and colon cancer. [provided by RefSeq, Aug 2016]
PHENOTYPE: Many homozygous null mutants die in utero by day 10.5 from yolk sac vasculature and hemopoietic defects. Survivors die by 5 weeks with wasting syndrome, excess inflammatory response and tissue necrosis. On BALB/c, mice develop necroinflammatory hepatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
4933408B17Rik T A 18: 34,580,841 M244L probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atg16l1 T C 1: 87,774,854 I279T possibly damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Cfap58 A T 19: 47,955,417 D352V probably benign Het
Cyp3a44 T A 5: 145,794,971 K122* probably null Het
Dnaic1 G T 4: 41,625,308 R424L probably benign Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Fgb C T 3: 83,046,787 S48N possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kcnj15 A G 16: 95,296,334 S272G probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Large2 G T 2: 92,370,870 probably benign Het
Maml2 A T 9: 13,621,551 probably benign Het
Me1 A G 9: 86,582,798 L533P possibly damaging Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr365 T A 2: 37,202,106 N288K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc25a17 A G 15: 81,337,953 V106A probably benign Het
Slc4a4 T G 5: 89,170,765 S640A probably benign Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Tek G T 4: 94,853,495 G830* probably null Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Tspan3 C T 9: 56,147,440 G108S probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in Tgfb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Tgfb1 APN 7 25688017 missense probably damaging 1.00
IGL03028:Tgfb1 APN 7 25704196 missense probably damaging 1.00
PIT4377001:Tgfb1 UTSW 7 25696918 missense probably benign
R0004:Tgfb1 UTSW 7 25692366 splice site probably benign
R0048:Tgfb1 UTSW 7 25694354 splice site probably benign
R0048:Tgfb1 UTSW 7 25694354 splice site probably benign
R0470:Tgfb1 UTSW 7 25687930 unclassified probably benign
R1872:Tgfb1 UTSW 7 25692466 missense probably damaging 1.00
R2178:Tgfb1 UTSW 7 25704809 missense probably damaging 1.00
R4581:Tgfb1 UTSW 7 25697230 missense possibly damaging 0.81
R5484:Tgfb1 UTSW 7 25688149 missense probably benign 0.00
R5663:Tgfb1 UTSW 7 25694281 missense possibly damaging 0.93
R5781:Tgfb1 UTSW 7 25696960 missense probably benign 0.00
R6548:Tgfb1 UTSW 7 25696925 missense probably benign 0.01
R7203:Tgfb1 UTSW 7 25692539 critical splice donor site probably null
R7449:Tgfb1 UTSW 7 25704838 missense probably damaging 1.00
R7654:Tgfb1 UTSW 7 25687695 unclassified probably benign
Z1177:Tgfb1 UTSW 7 25688208 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGAGCGAGTCCTCAAGAAATC -3'
(R):5'- ACACCTAAAGTTCCCCGGTC -3'

Sequencing Primer
(F):5'- CCTCAAGAAATCTAGAATACTGGGTC -3'
(R):5'- TCACACACGACGCTTGG -3'
Posted On2019-03-18