Mutagenetix > Incidental Mutation

Incidental Mutation 'R6667:Jph2'

543591

Institutional Source

Beutler Lab

Gene Symbol

Jph2

Ensembl Gene

ENSMUSG00000017817

Gene Name

junctophilin 2

Synonyms

1110002E14Rik, JP-2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6667 (G1)

Quality Score

53.0072

Status

Validated

Chromosome

Chromosomal Location

163336242-163397993 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 163376286 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 157 (S157P)

Ref Sequence

ENSEMBL: ENSMUSP00000105052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017961] [ENSMUST00000109425]

AlphaFold

Q9ET78

Predicted Effect

probably damaging
Transcript: ENSMUST00000017961
AA Change: S157P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000017961
Gene: ENSMUSG00000017817
AA Change: S157P

Domain	Start	End	E-Value	Type
MORN	12	33	7.12e0	SMART
MORN	58	79	3.01e0	SMART
Pfam:MORN	82	103	1.2e-2	PFAM
MORN	104	125	4.99e-5	SMART
MORN	127	148	3.67e-3	SMART
low complexity region	153	168	N/A	INTRINSIC
low complexity region	198	208	N/A	INTRINSIC
low complexity region	212	234	N/A	INTRINSIC
low complexity region	246	279	N/A	INTRINSIC
MORN	283	304	3.61e-2	SMART
MORN	306	327	6.23e-6	SMART
low complexity region	367	382	N/A	INTRINSIC
low complexity region	388	402	N/A	INTRINSIC
low complexity region	432	448	N/A	INTRINSIC
low complexity region	473	487	N/A	INTRINSIC
low complexity region	568	587	N/A	INTRINSIC
low complexity region	588	612	N/A	INTRINSIC
low complexity region	656	671	N/A	INTRINSIC
transmembrane domain	673	695	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109425
AA Change: S157P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105052
Gene: ENSMUSG00000017817
AA Change: S157P

Domain	Start	End	E-Value	Type
MORN	12	33	7.12e0	SMART
MORN	58	79	3.01e0	SMART
MORN	104	125	4.99e-5	SMART
MORN	127	148	3.67e-3	SMART
low complexity region	153	168	N/A	INTRINSIC
low complexity region	198	208	N/A	INTRINSIC
low complexity region	212	234	N/A	INTRINSIC
low complexity region	246	279	N/A	INTRINSIC
MORN	283	304	3.61e-2	SMART
MORN	306	327	6.23e-6	SMART
low complexity region	367	382	N/A	INTRINSIC
low complexity region	388	402	N/A	INTRINSIC
low complexity region	432	448	N/A	INTRINSIC
low complexity region	473	487	N/A	INTRINSIC
low complexity region	568	587	N/A	INTRINSIC
low complexity region	588	612	N/A	INTRINSIC
low complexity region	656	671	N/A	INTRINSIC
transmembrane domain	673	695	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. This gene is a member of the junctophilin gene family. Alternative splicing has been observed at this locus and two variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a deficiency of junctional membrane complexes in cardiac myocytes and die by embryonic day 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3100002H09Rik	G	T	4: 124,610,642	A39E	probably damaging	Het
Agtr1b	T	A	3: 20,315,749	N231I	possibly damaging	Het
Alpk2	T	C	18: 65,307,740	E661G	probably damaging	Het
Ankrd26	C	T	6: 118,507,788	S1496N	probably benign	Het
Asah2	T	C	19: 31,995,358	N659S	probably benign	Het
Atp12a	T	C	14: 56,384,188	V760A	possibly damaging	Het
Casp2	T	C	6: 42,279,836	C343R	probably damaging	Het
Cblb	T	A	16: 52,152,644	M446K	possibly damaging	Het
Cipc	T	C	12: 86,962,090	V241A	probably benign	Het
Ddit4l	A	G	3: 137,626,121	K83E	probably benign	Het
E430018J23Rik	A	G	7: 127,393,423	M5T	probably benign	Het
Epc2	A	G	2: 49,522,669	T220A	probably damaging	Het
Epha5	T	C	5: 84,071,191	D741G	probably damaging	Het
Flg2	A	T	3: 93,201,761	R365S	possibly damaging	Het
Ggn	A	T	7: 29,172,668	H491L	possibly damaging	Het
Gm21119	T	C	8: 20,621,939	S267P	probably benign	Het
Gm8332	A	T	12: 88,249,705	D132E	unknown	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Ighv6-4	A	G	12: 114,406,532	V100A	probably benign	Het
Invs	A	T	4: 48,402,870	Y501F	possibly damaging	Het
Iqcm	G	T	8: 75,753,352	G313W	probably damaging	Het
Mast4	T	C	13: 102,737,496	E1596G	probably damaging	Het
Mllt6	T	A	11: 97,676,934	L759Q	probably damaging	Het
Nalcn	A	G	14: 123,321,323	L837P	probably damaging	Het
Neb	G	A	2: 52,147,189	T6836I	probably damaging	Het
Nol12	T	A	15: 78,940,080	D133E	probably benign	Het
Olfr1136	A	G	2: 87,693,570	V104A	probably benign	Het
Oxtr	C	A	6: 112,477,099		probably benign	Het
Pcmt1	A	G	10: 7,663,149	L38P	probably damaging	Het
Pik3r2	T	C	8: 70,769,173	Y617C	probably damaging	Het
Prl7a2	T	C	13: 27,661,041	N121D	probably benign	Het
Pvr	G	T	7: 19,905,802	Q380K	probably benign	Het
Rtn2	A	G	7: 19,287,259	E188G	probably benign	Het
Setd4	C	A	16: 93,590,030	R260L	probably benign	Het
Six5	A	G	7: 19,096,569	N374D	probably benign	Het
Slc9b1	T	C	3: 135,371,965	I140T	probably damaging	Het
Supt16	A	G	14: 52,172,063	F797L	probably damaging	Het
Tbata	T	C	10: 61,185,363	L262P	probably damaging	Het
Tti1	A	T	2: 158,008,427	C297*	probably null	Het
Ush1c	C	A	7: 46,225,624	G139C	probably damaging	Het
Vmn1r1	C	T	1: 182,157,777	V108I	probably benign	Het
Vmn2r116	C	T	17: 23,401,092	T600I	probably damaging	Het
Zfp873	A	G	10: 82,060,589	T422A	probably benign	Het
Zfp943	G	A	17: 21,992,908	C325Y	probably damaging	Het

Other mutations in Jph2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01395:Jph2	APN	2	163339927	missense	probably benign	0.07
IGL02314:Jph2	APN	2	163397353	missense	probably damaging	1.00
IGL02565:Jph2	APN	2	163397345	missense	probably damaging	1.00
IGL02593:Jph2	APN	2	163397246	missense	probably damaging	1.00
IGL02713:Jph2	APN	2	163375917	missense	probably damaging	1.00
IGL02742:Jph2	APN	2	163375779	missense	probably damaging	1.00
R1479:Jph2	UTSW	2	163339271	missense	possibly damaging	0.62
R2069:Jph2	UTSW	2	163339685	missense	possibly damaging	0.81
R3848:Jph2	UTSW	2	163339412	missense	probably benign	0.22
R4961:Jph2	UTSW	2	163375748	missense	probably damaging	1.00
R6084:Jph2	UTSW	2	163375680	missense	probably damaging	1.00
R6377:Jph2	UTSW	2	163339712	missense	probably benign
R6874:Jph2	UTSW	2	163339487	missense	probably benign	0.24
R7112:Jph2	UTSW	2	163375784	missense	probably damaging	1.00
R7874:Jph2	UTSW	2	163375842	missense	probably damaging	1.00
R8109:Jph2	UTSW	2	163339286	missense	probably benign	0.00
R8196:Jph2	UTSW	2	163338701	critical splice acceptor site	probably null
R8802:Jph2	UTSW	2	163397264	missense	probably damaging	1.00
R9098:Jph2	UTSW	2	163339553	missense	probably damaging	1.00
R9228:Jph2	UTSW	2	163338686	missense	probably benign	0.11
R9274:Jph2	UTSW	2	163397627	start gained	probably benign
Z1088:Jph2	UTSW	2	163397332	missense	possibly damaging	0.94
Z1177:Jph2	UTSW	2	163376377	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCCAGTGATGTGCGTGATTC -3'
(R):5'- AGAATAACCTCTGCTCTCTTCGG -3'

Sequencing Primer
(F):5'- TGATTCTGAGCGTCGCAGC -3'
(R):5'- CTGACACAGCTCTCTTTG -3'

Posted On

2019-03-18