Incidental Mutation 'R6698:Olfr451-ps1'
ID 543592
Institutional Source Beutler Lab
Gene Symbol Olfr451-ps1
Ensembl Gene
Gene Name olfactory receptor 451, pseudogene 1
Synonyms MOR257-6, GA_x6K02T2P3E9-4759141-4758206
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock # R6698 (G1)
Quality Score 61.0073
Status Validated
Chromosome 6
Chromosomal Location 42800743-42801675 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 42801202 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 154 (T154S)
Ref Sequence ENSEMBL: ENSMUSP00000144800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000205127]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000205127
AA Change: T154S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144800
Gene: ENSMUSG00000108058
AA Change: T154S

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 2.1e-46 PFAM
Pfam:7tm_1 41 288 1.4e-16 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Park2 A G 17: 11,067,296 probably null Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Olfr451-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6285:Olfr451-ps1 UTSW 6 42800909 missense probably benign 0.44
R7890:Olfr451-ps1 UTSW 6 42801492 nonsense probably null
R8272:Olfr451-ps1 UTSW 6 42801104 missense probably damaging 1.00
R9321:Olfr451-ps1 UTSW 6 42800858 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGTCCATCCCGTTTCACAG -3'
(R):5'- ATGGCAGCAACAATGTGAGC -3'

Sequencing Primer
(F):5'- CAGTTGTGTGATGCAGCTGTATATC -3'
(R):5'- TGTGAGCATAGGAAAACAGCACC -3'
Posted On 2019-03-21