Mutagenetix > Incidental Mutations

Incidental Mutation 'R6698:Mark4'

543593

Institutional Source

Beutler Lab

Gene Symbol

Mark4

Ensembl Gene

ENSMUSG00000030397

Gene Name

MAP/microtubule affinity regulating kinase 4

Synonyms

Markl1, 2410090P21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6698 (G1)

Quality Score

55.0072

Status

Validated

Chromosome

Chromosomal Location

19424775-19458821 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 19429437 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 589 (N589S)

Ref Sequence

ENSEMBL: ENSMUSP00000082862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085715] [ENSMUST00000209058]

Predicted Effect

probably benign
Transcript: ENSMUST00000085715
AA Change: N589S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000082862
Gene: ENSMUSG00000030397
AA Change: N589S

Domain	Start	End	E-Value	Type
S_TKc	59	310	1.4e-109	SMART
UBA	331	368	9.62e-8	SMART
low complexity region	391	408	N/A	INTRINSIC
low complexity region	463	474	N/A	INTRINSIC
low complexity region	540	553	N/A	INTRINSIC
low complexity region	580	586	N/A	INTRINSIC
low complexity region	672	690	N/A	INTRINSIC
Pfam:KA1	709	752	1.4e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000209058

Meta Mutation Damage Score

0.0677

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule affinity-regulating kinase family. These protein kinases phosphorylate microtubule-associated proteins and regulate the transition between stable and dynamic microtubules. The encoded protein is associated with the centrosome throughout mitosis and may be involved in cell cycle control. Expression of this gene is a potential marker for cancer, and the encoded protein may also play a role in Alzheimer's disease. Pseudogenes of this gene are located on both the short and long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit insulin hypersensitivity and resistance to diet-induced obersity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Brca2	T	C	5: 150,532,394	V200A	probably damaging	Het
Camk2g	T	A	14: 20,742,708	K393*	probably null	Het
Catsperb	T	A	12: 101,509,207	F337I	probably damaging	Het
Cdk17	T	C	10: 93,228,678	Y270H	probably damaging	Het
Col5a3	C	T	9: 20,779,033	G1162R	probably damaging	Het
Col6a5	T	A	9: 105,934,175	N715I	unknown	Het
Fam198b	A	G	3: 79,936,595	I10V	probably damaging	Het
Fancg	A	G	4: 43,007,034	S248P	probably benign	Het
Flvcr1	T	C	1: 191,025,732	Y79C	probably damaging	Het
Gabrp	A	G	11: 33,557,017	S198P	probably damaging	Het
Glp1r	A	G	17: 30,936,401	Y454C	probably damaging	Het
Gpr158	A	C	2: 21,827,110	D1007A	probably damaging	Het
Gsdmc3	A	G	15: 63,860,271	F302S	possibly damaging	Het
Gsdmc4	T	A	15: 63,893,764	D312V	probably benign	Het
Itga5	T	C	15: 103,351,381	Y663C	probably benign	Het
Kif1b	A	T	4: 149,274,956	M108K	probably damaging	Het
Klf11	T	G	12: 24,653,619	S18A	probably damaging	Het
Lmtk2	T	C	5: 144,174,919	V819A	probably benign	Het
Lrba	A	G	3: 86,304,425	M451V	probably damaging	Het
Lrp1b	T	C	2: 41,302,946	D488G	probably damaging	Het
Mis12	T	C	11: 71,025,186	F15S	probably damaging	Het
Nif3l1	A	G	1: 58,450,489	D179G	probably benign	Het
Nlrx1	A	G	9: 44,265,807	W3R	probably damaging	Het
Nup210l	G	A	3: 90,182,508	S1194N	possibly damaging	Het
Olfr1165-ps	A	G	2: 88,101,217	F257L	unknown	Het
Olfr451-ps1	A	T	6: 42,801,202	T154S	probably benign	Het
Park2	A	G	17: 11,067,296		probably null	Het
Pnkd	T	A	1: 74,350,677	L320Q	probably damaging	Het
Rcc2	G	A	4: 140,702,275	C40Y	probably benign	Homo
Rilpl2	C	T	5: 124,469,780	E126K	probably damaging	Het
Rpn2	T	C	2: 157,297,410	I208T	possibly damaging	Het
Skint4	G	T	4: 112,119,899	C170F	probably damaging	Het
Synj1	C	G	16: 90,960,452	V877L	probably damaging	Het
Tcp11	A	T	17: 28,071,830	I106N	possibly damaging	Het
Tg	A	G	15: 66,839,362	Y991C	probably damaging	Het
Trib3	A	G	2: 152,338,419	S285P	probably damaging	Het
Wdr49	A	T	3: 75,429,366	W345R	probably benign	Het
Wnt5a	A	G	14: 28,518,463	Y190C	possibly damaging	Het
Xpo1	A	G	11: 23,294,040	E955G	probably benign	Het

Other mutations in Mark4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mark4	APN	7	19431824	missense	possibly damaging	0.50
IGL02321:Mark4	APN	7	19426389	missense	probably benign
IGL02813:Mark4	APN	7	19447256	splice site	probably null
IGL03088:Mark4	APN	7	19451584	missense	probably damaging	1.00
R0555:Mark4	UTSW	7	19448673	splice site	probably benign
R1278:Mark4	UTSW	7	19431770	missense	probably damaging	0.99
R1385:Mark4	UTSW	7	19426027	unclassified	probably null
R3415:Mark4	UTSW	7	19451725	missense	probably benign	0.00
R3828:Mark4	UTSW	7	19443187	missense	possibly damaging	0.65
R4281:Mark4	UTSW	7	19433446	missense	probably benign	0.09
R4682:Mark4	UTSW	7	19445172	splice site	probably null
R4791:Mark4	UTSW	7	19451657	missense	probably benign	0.19
R5184:Mark4	UTSW	7	19447243	missense	possibly damaging	0.95
R5319:Mark4	UTSW	7	19436961	missense	possibly damaging	0.95
R5330:Mark4	UTSW	7	19436983	missense	probably damaging	1.00
R5488:Mark4	UTSW	7	19429607	splice site	probably null
R5811:Mark4	UTSW	7	19448639	missense	probably damaging	1.00
R6058:Mark4	UTSW	7	19426385	missense	probably benign	0.10
R6148:Mark4	UTSW	7	19429516	missense	probably benign	0.00
R6333:Mark4	UTSW	7	19443283	missense	probably damaging	0.98
R7265:Mark4	UTSW	7	19451725	missense	probably benign	0.00
R7429:Mark4	UTSW	7	19426167	missense	probably damaging	0.99
R7664:Mark4	UTSW	7	19443226	missense	probably damaging	1.00
R8027:Mark4	UTSW	7	19447239	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- AGTTCTGCCGTTTAGAGGGATC -3'
(R):5'- TCCATAATGCCCTGACAGCC -3'

Sequencing Primer
(F):5'- CCGTTTAGAGGGATCGAGGGTAAC -3'
(R):5'- ATAATGCCCTGACAGCCTTCCG -3'

Posted On

2019-03-21