Incidental Mutation 'R6767:Fasn'
ID543594
Institutional Source Beutler Lab
Gene Symbol Fasn
Ensembl Gene ENSMUSG00000025153
Gene Namefatty acid synthase
SynonymsFAS, A630082H08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6767 (G1)
Quality Score70.0074
Status Validated
Chromosome11
Chromosomal Location120805846-120824547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120817487 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 651 (I651V)
Ref Sequence ENSEMBL: ENSMUSP00000145585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055655] [ENSMUST00000206589]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055655
AA Change: I651V

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052872
Gene: ENSMUSG00000025153
AA Change: I651V

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 1 239 6.8e-73 PFAM
Pfam:Ketoacyl-synt_C 243 360 3.7e-38 PFAM
Pfam:KAsynt_C_assoc 362 474 8.2e-46 PFAM
Pfam:Acyl_transf_1 493 810 9.5e-115 PFAM
Pfam:PS-DH 853 1169 9.9e-24 PFAM
low complexity region 1175 1204 N/A INTRINSIC
Pfam:Methyltransf_12 1238 1337 2e-9 PFAM
PKS_ER 1532 1847 1.44e-147 SMART
PKS_KR 1878 2059 2.33e-42 SMART
Pfam:PP-binding 2119 2185 1.1e-10 PFAM
Pfam:Thioesterase 2235 2494 1.6e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000206589
AA Change: I651V

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.2047 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is a multifunctional protein. Its main function is to catalyze the synthesis of palmitate from acetyl-CoA and malonyl-CoA, in the presence of NADPH, into long-chain saturated fatty acids. In some cancer cell lines, this protein has been found to be fused with estrogen receptor-alpha (ER-alpha), in which the N-terminus of FAS is fused in-frame with the C-terminus of ER-alpha. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutation of this locus has implicated its product in embryogenesis as all homozygotes and most heterozygotes die prior to birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,766,607 N537D probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Atp8a2 A G 14: 60,046,722 F47S probably damaging Het
Cadps T A 14: 12,550,888 T449S probably damaging Het
Ccdc33 C G 9: 58,033,244 Q489H possibly damaging Het
Cd163 T G 6: 124,304,779 S14A possibly damaging Het
Cemip G A 7: 83,998,624 L83F probably damaging Het
Chrd C T 16: 20,738,626 P665L probably benign Het
Cib4 T A 5: 30,534,245 H44L probably benign Het
Clic1 T A 17: 35,053,053 L99Q probably benign Het
Cnst C T 1: 179,609,954 T361I possibly damaging Het
Dnah6 C A 6: 73,133,608 V1613L probably benign Het
Dnajb8 T C 6: 88,222,652 S57P probably damaging Het
Dyrk3 T C 1: 131,129,590 H282R probably damaging Het
Gas6 A G 8: 13,465,784 S663P probably damaging Het
Gbp8 T C 5: 105,018,612 M284V probably benign Het
Gm12695 T C 4: 96,762,696 probably null Het
Gm17359 A T 3: 79,430,023 D46V probably benign Het
Gm5346 G A 8: 43,626,914 T91I probably damaging Het
Gm6034 T A 17: 36,043,131 M1K probably null Het
Gm9376 A G 14: 118,267,236 T27A unknown Het
Grid2 A G 6: 63,931,015 D213G probably benign Het
Gsdma3 A T 11: 98,637,884 D388V possibly damaging Het
Hdac9 T A 12: 34,287,529 H716L probably damaging Het
Hist1h4b T A 13: 23,757,022 M1K probably null Het
Hivep1 T C 13: 42,154,727 S148P probably damaging Het
Kctd1 T C 18: 15,062,175 T464A possibly damaging Het
Kera A G 10: 97,609,172 D131G possibly damaging Het
Kif2c C T 4: 117,178,188 R21Q probably benign Het
Luc7l3 G T 11: 94,292,953 D453E probably damaging Het
Mrpl9 A G 3: 94,450,221 probably benign Het
Mtss1 T C 15: 58,953,581 S257G probably benign Het
N4bp2 T C 5: 65,817,187 F1467L probably damaging Het
Naa25 T C 5: 121,439,865 V945A probably damaging Het
Nrg1 T C 8: 31,917,895 I103M probably damaging Het
Olfr1369-ps1 C T 13: 21,116,057 R122C probably benign Het
Orm3 C T 4: 63,356,294 T32I probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Plch1 A T 3: 63,755,344 M246K probably damaging Het
Pld4 A C 12: 112,764,115 D144A possibly damaging Het
Prelp C A 1: 133,912,710 V345L probably benign Het
Rnf121 A G 7: 102,023,412 F238L probably damaging Het
Rnf40 A G 7: 127,596,585 K667R possibly damaging Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Serpina3n T G 12: 104,409,062 V131G probably benign Het
Slc22a21 T C 11: 53,979,502 Y119C probably damaging Het
Slc22a28 A G 19: 8,117,045 F204S probably damaging Het
Smc6 T A 12: 11,271,820 D29E possibly damaging Het
Smgc T A 15: 91,841,398 F40Y possibly damaging Het
Sorcs3 G T 19: 48,713,571 L630F probably damaging Het
Sphk1 A G 11: 116,536,156 K306E possibly damaging Het
Spsb1 C T 4: 149,906,844 G89D probably damaging Het
Stat4 G T 1: 52,076,583 M227I probably benign Het
Syngr4 A G 7: 45,887,491 V116A possibly damaging Het
Tacc1 T C 8: 25,240,800 M1V probably null Het
Tcf7l1 T G 6: 72,631,292 K355Q probably damaging Het
Tmem192 T C 8: 64,964,236 S36P probably damaging Het
Top3a G T 11: 60,750,753 N368K possibly damaging Het
Tpk1 T A 6: 43,346,793 I241F possibly damaging Het
Trappc10 A G 10: 78,193,511 I1064T possibly damaging Het
Vmn1r18 T A 6: 57,390,221 K116M probably damaging Het
Vmn2r40 A T 7: 8,920,140 H407Q unknown Het
Vmn2r91 T A 17: 18,107,545 L467H probably damaging Het
Wdr59 G T 8: 111,476,101 S603R probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp324 A C 7: 12,970,600 K74N probably null Het
Zfyve16 A G 13: 92,508,199 L1165P probably damaging Het
Other mutations in Fasn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Fasn APN 11 120820539 missense probably damaging 1.00
IGL01014:Fasn APN 11 120817229 missense probably damaging 0.99
IGL01131:Fasn APN 11 120814619 missense probably benign 0.01
IGL01603:Fasn APN 11 120816065 missense probably damaging 0.99
IGL01606:Fasn APN 11 120809023 critical splice donor site probably null
IGL01897:Fasn APN 11 120807939 missense probably damaging 1.00
IGL01899:Fasn APN 11 120820149 splice site probably benign
IGL01987:Fasn APN 11 120818073 missense probably damaging 1.00
IGL02103:Fasn APN 11 120811936 missense probably damaging 1.00
IGL02212:Fasn APN 11 120807903 missense probably damaging 1.00
IGL02294:Fasn APN 11 120810276 missense probably damaging 0.98
IGL02336:Fasn APN 11 120813736 missense possibly damaging 0.48
IGL02417:Fasn APN 11 120820340 missense probably damaging 1.00
IGL02452:Fasn APN 11 120808180 missense probably benign 0.00
IGL02559:Fasn APN 11 120809066 missense possibly damaging 0.51
IGL02724:Fasn APN 11 120809833 missense probably benign 0.41
IGL02862:Fasn APN 11 120818979 missense possibly damaging 0.89
IGL02947:Fasn APN 11 120815676 missense probably damaging 0.99
IGL03025:Fasn APN 11 120818148 missense probably benign 0.01
IGL03131:Fasn APN 11 120810724 missense possibly damaging 0.93
IGL03157:Fasn APN 11 120807909 missense probably benign 0.12
IGL03182:Fasn APN 11 120812726 missense probably damaging 1.00
IGL03370:Fasn APN 11 120812795 missense possibly damaging 0.95
R0019:Fasn UTSW 11 120807998 splice site probably benign
R0019:Fasn UTSW 11 120807998 splice site probably benign
R0243:Fasn UTSW 11 120815315 missense probably benign 0.00
R0304:Fasn UTSW 11 120819936 missense possibly damaging 0.85
R0389:Fasn UTSW 11 120816182 missense probably damaging 1.00
R0449:Fasn UTSW 11 120811068 missense probably benign
R0626:Fasn UTSW 11 120811925 missense probably damaging 0.99
R1037:Fasn UTSW 11 120809451 missense probably benign
R1061:Fasn UTSW 11 120822182 unclassified probably null
R1109:Fasn UTSW 11 120812324 missense possibly damaging 0.77
R1467:Fasn UTSW 11 120811040 missense probably benign 0.07
R1467:Fasn UTSW 11 120811040 missense probably benign 0.07
R1498:Fasn UTSW 11 120815419 missense probably damaging 0.98
R1552:Fasn UTSW 11 120818558 missense probably damaging 1.00
R1568:Fasn UTSW 11 120813249 missense possibly damaging 0.78
R1624:Fasn UTSW 11 120813111 missense probably damaging 1.00
R1774:Fasn UTSW 11 120817171 missense probably damaging 1.00
R1826:Fasn UTSW 11 120808499 splice site probably benign
R1846:Fasn UTSW 11 120813307 missense probably benign 0.00
R2298:Fasn UTSW 11 120813816 missense possibly damaging 0.78
R2513:Fasn UTSW 11 120814748 missense probably damaging 1.00
R3001:Fasn UTSW 11 120809845 missense probably benign
R3002:Fasn UTSW 11 120809845 missense probably benign
R3154:Fasn UTSW 11 120807939 missense probably damaging 1.00
R3434:Fasn UTSW 11 120822773 missense probably damaging 0.99
R4794:Fasn UTSW 11 120811295 missense probably benign 0.36
R4840:Fasn UTSW 11 120813059 missense possibly damaging 0.83
R4863:Fasn UTSW 11 120808828 missense probably damaging 1.00
R4876:Fasn UTSW 11 120812312 missense probably damaging 1.00
R4914:Fasn UTSW 11 120816646 missense probably benign 0.39
R4915:Fasn UTSW 11 120816646 missense probably benign 0.39
R4916:Fasn UTSW 11 120816646 missense probably benign 0.39
R4918:Fasn UTSW 11 120816646 missense probably benign 0.39
R4936:Fasn UTSW 11 120816085 missense probably damaging 1.00
R5025:Fasn UTSW 11 120811908 missense probably benign 0.00
R5092:Fasn UTSW 11 120815036 missense probably benign 0.00
R5120:Fasn UTSW 11 120811391 missense probably benign 0.22
R5175:Fasn UTSW 11 120816369 missense probably benign 0.14
R5183:Fasn UTSW 11 120808882 missense probably benign 0.44
R5506:Fasn UTSW 11 120809510 missense probably benign 0.26
R5557:Fasn UTSW 11 120812426 missense probably benign 0.10
R5614:Fasn UTSW 11 120813328 missense probably benign
R5728:Fasn UTSW 11 120813513 missense probably benign 0.06
R5838:Fasn UTSW 11 120816124 missense probably damaging 0.98
R5959:Fasn UTSW 11 120808564 missense probably damaging 0.99
R6029:Fasn UTSW 11 120820909 missense probably damaging 1.00
R6134:Fasn UTSW 11 120822186 missense probably benign 0.05
R6335:Fasn UTSW 11 120815359 missense probably damaging 0.96
R6452:Fasn UTSW 11 120815411 missense probably damaging 1.00
R6627:Fasn UTSW 11 120818927 missense probably benign 0.10
R6742:Fasn UTSW 11 120810453 missense probably damaging 0.96
R6927:Fasn UTSW 11 120808289 missense probably benign 0.03
R6976:Fasn UTSW 11 120819867 missense probably damaging 1.00
R7092:Fasn UTSW 11 120820120 missense possibly damaging 0.56
R7157:Fasn UTSW 11 120810465 nonsense probably null
R7373:Fasn UTSW 11 120813976 missense possibly damaging 0.81
R7575:Fasn UTSW 11 120812687 missense possibly damaging 0.93
R7652:Fasn UTSW 11 120816328 missense probably damaging 0.97
R7670:Fasn UTSW 11 120813419 missense probably damaging 1.00
R7806:Fasn UTSW 11 120809995 missense probably benign 0.00
R8007:Fasn UTSW 11 120809527 missense probably benign
R8012:Fasn UTSW 11 120811602 missense probably damaging 1.00
X0067:Fasn UTSW 11 120816303 critical splice donor site probably null
Z1177:Fasn UTSW 11 120815471 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATTCATTCACTGCAGCCTGC -3'
(R):5'- CGGACATTTGTCATTTCACCAAC -3'

Sequencing Primer
(F):5'- CCTGCAGGCATCAAGGAG -3'
(R):5'- ACAACATTGGCCCCAGGTAGTG -3'
Posted On2019-03-21