Incidental Mutation 'R6762:Trpm4'
ID 543608
Institutional Source Beutler Lab
Gene Symbol Trpm4
Ensembl Gene ENSMUSG00000038260
Gene Name transient receptor potential cation channel, subfamily M, member 4
Synonyms LTRPC4, TRPM4B, 1110030C19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock # R6762 (G1)
Quality Score 191.009
Status Validated
Chromosome 7
Chromosomal Location 45302632-45333780 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) A to G at 45304816 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042194] [ENSMUST00000209506] [ENSMUST00000210311] [ENSMUST00000211431] [ENSMUST00000211743]
AlphaFold Q7TN37
Predicted Effect silent
Transcript: ENSMUST00000042194
SMART Domains Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260

DomainStartEndE-ValueType
low complexity region 118 131 N/A INTRINSIC
SCOP:d1awcb_ 378 465 2e-3 SMART
low complexity region 600 612 N/A INTRINSIC
low complexity region 637 645 N/A INTRINSIC
transmembrane domain 688 710 N/A INTRINSIC
Pfam:Ion_trans 781 1051 1.8e-13 PFAM
low complexity region 1089 1096 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209506
AA Change: S47P
Predicted Effect silent
Transcript: ENSMUST00000210311
Predicted Effect probably benign
Transcript: ENSMUST00000211431
Predicted Effect silent
Transcript: ENSMUST00000211743
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display increased Ca2+ influx and IgE-dependent mast cell activation, increased vascular permeability, and enhanced acute anaphylactic responses. Mice homozygous for a different knock-out allele show Ca2+ overload and impaired dendritic cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,668 Y27H probably benign Het
Angptl3 T A 4: 99,037,417 S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,117,050 probably benign Het
Cyp2s1 A T 7: 25,808,070 L318H probably damaging Het
Dnah14 T C 1: 181,757,259 L3185P probably damaging Het
Dnah7b T C 1: 46,224,742 V2128A probably benign Het
Ehhadh A T 16: 21,762,459 F594L probably benign Het
En2 A G 5: 28,170,353 N298S possibly damaging Het
Epha5 T A 5: 84,331,726 N140Y probably damaging Het
Fam151b C T 13: 92,468,050 V144I possibly damaging Het
Fanca C A 8: 123,271,303 A1215S probably benign Het
Fancd2 T A 6: 113,586,016 probably null Het
Fat2 T C 11: 55,253,482 probably null Het
Gm4513 T C 7: 20,594,193 N31S probably benign Het
Hspg2 A T 4: 137,551,803 I3066F possibly damaging Het
Krt10 T C 11: 99,387,057 T355A possibly damaging Het
Lims1 C A 10: 58,412,545 H275N probably damaging Het
Map3k19 C T 1: 127,847,264 G112D probably damaging Het
Mdn1 T A 4: 32,676,786 N619K possibly damaging Het
Mpp6 T A 6: 50,180,438 probably null Het
Mtor A G 4: 148,538,481 T1977A possibly damaging Het
Nos2 T G 11: 78,959,748 L1144R possibly damaging Het
Olfr1085 A T 2: 86,657,844 F205I probably benign Het
Olfr608 G C 7: 103,470,389 V117L probably benign Het
Olfr780 G A 10: 129,322,256 C211Y probably damaging Het
Pcdhga9 C A 18: 37,737,268 S50Y probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Prep T C 10: 45,148,123 probably null Het
Qtrt1 T A 9: 21,412,082 H76Q probably damaging Het
Rpa1 T A 11: 75,340,345 S73C possibly damaging Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Snapc3 T C 4: 83,435,258 L178P probably damaging Het
Sptbn4 A G 7: 27,394,208 F1340L probably damaging Het
Srd5a3 T A 5: 76,153,551 I85K probably benign Het
Taar2 C T 10: 23,941,402 T280M probably damaging Het
Tgfb3 T C 12: 86,069,463 D177G probably benign Het
Tpt1 A G 14: 75,846,381 D94G probably benign Het
Trpv4 C T 5: 114,625,110 R746H probably benign Het
Txndc2 T C 17: 65,638,972 D70G probably damaging Het
Ugcg T A 4: 59,219,530 I289N possibly damaging Het
Vmn2r2 C G 3: 64,134,449 D282H probably damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Wdpcp C T 11: 21,721,244 T495I probably benign Het
Zfp961 T A 8: 71,966,114 C51S possibly damaging Het
Zxdc C T 6: 90,382,183 A599V probably benign Het
Other mutations in Trpm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Trpm4 APN 7 45318349 missense probably benign
IGL01327:Trpm4 APN 7 45315073 missense probably damaging 1.00
IGL02069:Trpm4 APN 7 45319294 missense probably damaging 1.00
IGL02124:Trpm4 APN 7 45310523 missense probably damaging 1.00
IGL02141:Trpm4 APN 7 45318179 splice site probably null
IGL02333:Trpm4 APN 7 45322115 missense possibly damaging 0.85
IGL02338:Trpm4 APN 7 45326998 missense probably damaging 1.00
IGL02741:Trpm4 APN 7 45318488 missense possibly damaging 0.82
R0041:Trpm4 UTSW 7 45304946 critical splice donor site probably null
R0106:Trpm4 UTSW 7 45319240 critical splice donor site probably null
R0270:Trpm4 UTSW 7 45319253 missense possibly damaging 0.45
R0279:Trpm4 UTSW 7 45322048 missense probably damaging 0.99
R0309:Trpm4 UTSW 7 45308706 missense probably damaging 1.00
R0539:Trpm4 UTSW 7 45305472 missense probably damaging 0.99
R0969:Trpm4 UTSW 7 45327907 intron probably benign
R1454:Trpm4 UTSW 7 45317056 missense probably damaging 0.99
R1512:Trpm4 UTSW 7 45315044 missense probably benign 0.07
R1579:Trpm4 UTSW 7 45308597 missense probably damaging 1.00
R1768:Trpm4 UTSW 7 45308612 missense probably damaging 0.97
R2847:Trpm4 UTSW 7 45310598 missense probably damaging 1.00
R3883:Trpm4 UTSW 7 45321998 critical splice donor site probably null
R3884:Trpm4 UTSW 7 45321998 critical splice donor site probably null
R4895:Trpm4 UTSW 7 45318058 missense probably damaging 0.98
R5056:Trpm4 UTSW 7 45308630 missense probably damaging 0.98
R5060:Trpm4 UTSW 7 45321834 missense probably damaging 1.00
R5069:Trpm4 UTSW 7 45310469 missense probably damaging 1.00
R5560:Trpm4 UTSW 7 45310332 missense probably damaging 1.00
R5783:Trpm4 UTSW 7 45310389 missense probably benign
R5874:Trpm4 UTSW 7 45327749 missense probably damaging 1.00
R6176:Trpm4 UTSW 7 45326676 missense probably damaging 1.00
R6302:Trpm4 UTSW 7 45327719 critical splice donor site probably null
R6431:Trpm4 UTSW 7 45326568 missense possibly damaging 0.79
R6827:Trpm4 UTSW 7 45318628 missense possibly damaging 0.89
R6845:Trpm4 UTSW 7 45322329 missense possibly damaging 0.88
R6950:Trpm4 UTSW 7 45319280 missense probably damaging 0.97
R7126:Trpm4 UTSW 7 45310709 splice site probably null
R7159:Trpm4 UTSW 7 45327268 splice site probably null
R7167:Trpm4 UTSW 7 45327719 critical splice donor site probably null
R7386:Trpm4 UTSW 7 45314640 missense possibly damaging 0.47
R7516:Trpm4 UTSW 7 45305020 missense probably damaging 1.00
R7655:Trpm4 UTSW 7 45321809 missense probably benign 0.00
R7656:Trpm4 UTSW 7 45321809 missense probably benign 0.00
R7743:Trpm4 UTSW 7 45308338 missense probably benign 0.14
R7943:Trpm4 UTSW 7 45308681 missense probably damaging 1.00
R7955:Trpm4 UTSW 7 45319259 missense probably damaging 1.00
R8060:Trpm4 UTSW 7 45305451 missense probably damaging 1.00
R8119:Trpm4 UTSW 7 45327128 missense probably damaging 1.00
R8225:Trpm4 UTSW 7 45305334 missense probably benign
R8395:Trpm4 UTSW 7 45309210 missense probably benign 0.00
R8509:Trpm4 UTSW 7 45322361 missense probably damaging 1.00
R8897:Trpm4 UTSW 7 45310631 missense probably benign 0.02
R9577:Trpm4 UTSW 7 45305008 nonsense probably null
R9674:Trpm4 UTSW 7 45333387 missense possibly damaging 0.87
R9731:Trpm4 UTSW 7 45308630 missense probably damaging 0.98
X0018:Trpm4 UTSW 7 45314634 missense possibly damaging 0.61
X0022:Trpm4 UTSW 7 45310511 missense probably damaging 1.00
Z1177:Trpm4 UTSW 7 45326718 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGACCTTTGGAACCAGTGGG -3'
(R):5'- AGAGAACTTCCTGTTGGCAC -3'

Sequencing Primer
(F):5'- TTGGAACCAGTGGGGCTCG -3'
(R):5'- CACAAGCTCGGGACAAGCG -3'
Posted On 2019-03-29