Incidental Mutation 'R6812:Dennd5b'
ID 543610
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission 044924-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R6812 (G1)
Quality Score 72.0074
Status Validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) T to C at 148982630 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557] [ENSMUST00000127727] [ENSMUST00000145555]
AlphaFold A2RSQ0
Predicted Effect probably benign
Transcript: ENSMUST00000111557
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127727
SMART Domains Protein: ENSMUSP00000123568
Gene: ENSMUSG00000030313

DomainStartEndE-ValueType
uDENN 18 142 5.45e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145555
SMART Domains Protein: ENSMUSP00000127731
Gene: ENSMUSG00000030313

DomainStartEndE-ValueType
uDENN 1 42 3.03e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 97.4%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 C T 16: 56,616,161 (GRCm39) probably benign Het
Ak9 A T 10: 41,243,163 (GRCm39) M686L unknown Het
Ap3b1 A T 13: 94,616,369 (GRCm39) T757S unknown Het
Apob A T 12: 8,033,062 (GRCm39) K139N probably damaging Het
Arid4a A G 12: 71,094,037 (GRCm39) E270G possibly damaging Het
Atp1a2 A T 1: 172,112,444 (GRCm39) C515S probably benign Het
Bicd1 T C 6: 149,311,035 (GRCm39) Y37H probably damaging Het
Birc2 T G 9: 7,854,418 (GRCm39) D424A probably damaging Het
Ccdc97 A T 7: 25,412,469 (GRCm39) F324L probably damaging Het
Crim1 T A 17: 78,623,029 (GRCm39) I409N probably damaging Het
Cul7 T A 17: 46,972,335 (GRCm39) I1233N probably benign Het
Dcaf1 T C 9: 106,735,268 (GRCm39) S739P probably damaging Het
Ddb1 T C 19: 10,599,863 (GRCm39) probably null Het
Dna2 A G 10: 62,795,120 (GRCm39) S464G probably benign Het
Dnah9 C T 11: 65,872,155 (GRCm39) V2692M probably damaging Het
Dvl2 T C 11: 69,891,821 (GRCm39) Y55H probably damaging Het
Eif4g3 G T 4: 137,830,687 (GRCm39) Q140H probably damaging Het
Enpp5 G A 17: 44,396,467 (GRCm39) V460M probably benign Het
Etv2 G T 7: 30,333,426 (GRCm39) C265* probably null Het
F12 T C 13: 55,569,658 (GRCm39) E146G probably damaging Het
Fdps C A 3: 89,001,783 (GRCm39) E301D possibly damaging Het
Fsd2 G T 7: 81,184,837 (GRCm39) H686Q probably benign Het
Gk5 T C 9: 96,032,802 (GRCm39) S262P probably damaging Het
Gm20730 A G 6: 43,058,722 (GRCm39) V30A probably benign Het
Gpr68 C A 12: 100,844,670 (GRCm39) E291D probably damaging Het
Gucy2c A G 6: 136,674,993 (GRCm39) V1006A probably benign Het
Itgb1 T A 8: 129,431,891 (GRCm39) probably null Het
Kif2a A T 13: 107,106,259 (GRCm39) D570E probably benign Het
Krt8 G T 15: 101,906,414 (GRCm39) A365D probably damaging Het
Lias T A 5: 65,566,132 (GRCm39) V373E possibly damaging Het
Mpl A G 4: 118,312,461 (GRCm39) V169A probably benign Het
Myh3 T A 11: 66,977,228 (GRCm39) I319N probably damaging Het
Myrfl T A 10: 116,668,818 (GRCm39) K315I probably damaging Het
Nrap T C 19: 56,340,108 (GRCm39) D803G probably damaging Het
Obi1 A G 14: 104,747,868 (GRCm39) V40A unknown Het
Or5b119 T C 19: 13,456,975 (GRCm39) T196A probably benign Het
Pald1 A G 10: 61,178,701 (GRCm39) S536P possibly damaging Het
Phka2 G A X: 159,316,044 (GRCm39) V230I probably damaging Het
Prkaa2 T A 4: 104,904,349 (GRCm39) T243S probably benign Het
Prrc2b T A 2: 32,103,153 (GRCm39) V877D probably benign Het
Rbm27 T A 18: 42,466,468 (GRCm39) probably null Het
Rbm48 A G 5: 3,646,105 (GRCm39) V33A probably benign Het
Rev3l G T 10: 39,699,544 (GRCm39) R1347L probably benign Het
Rtp3 A G 9: 110,816,180 (GRCm39) F124L probably benign Het
Ryr3 C T 2: 112,777,251 (GRCm39) G302D probably damaging Het
Scnn1a A G 6: 125,314,819 (GRCm39) N314S probably benign Het
Sik3 C T 9: 46,122,067 (GRCm39) R907W probably damaging Het
Sox5 C T 6: 144,062,169 (GRCm39) probably null Het
Tmc1 A C 19: 20,878,225 (GRCm39) L90R probably damaging Het
Tmtc2 A G 10: 105,249,130 (GRCm39) V201A probably benign Het
Uvrag T A 7: 98,537,689 (GRCm39) H502L probably benign Het
Vwa8 T A 14: 79,434,859 (GRCm39) I1760N probably damaging Het
Zfp318 G GAAGAAT 17: 46,723,468 (GRCm39) probably benign Het
Zfp772 T C 7: 7,209,307 (GRCm39) D61G possibly damaging Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1241:Dennd5b UTSW 6 148,969,988 (GRCm39) missense probably benign 0.06
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148,899,782 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1861:Dennd5b UTSW 6 148,969,760 (GRCm39) missense probably damaging 1.00
R1907:Dennd5b UTSW 6 148,943,074 (GRCm39) missense probably benign 0.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4654:Dennd5b UTSW 6 148,908,335 (GRCm39) missense probably damaging 1.00
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6082:Dennd5b UTSW 6 148,970,193 (GRCm39) missense probably damaging 0.99
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7231:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7751:Dennd5b UTSW 6 148,918,604 (GRCm39) missense probably benign 0.01
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7770:Dennd5b UTSW 6 148,943,214 (GRCm39) missense probably damaging 0.99
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7854:Dennd5b UTSW 6 148,969,964 (GRCm39) missense probably benign 0.00
R7899:Dennd5b UTSW 6 148,943,159 (GRCm39) missense probably damaging 1.00
R8226:Dennd5b UTSW 6 148,915,746 (GRCm39) splice site probably null
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8489:Dennd5b UTSW 6 148,986,389 (GRCm39) missense probably benign 0.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R8966:Dennd5b UTSW 6 148,901,474 (GRCm39) missense probably damaging 1.00
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9535:Dennd5b UTSW 6 148,895,365 (GRCm39) missense probably benign 0.03
R9541:Dennd5b UTSW 6 148,899,872 (GRCm39) missense probably benign 0.00
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAATGTTCTTCTCAGAGGACTC -3'
(R):5'- GTGGGTATAGTAATTACATGACACC -3'

Sequencing Primer
(F):5'- GAGGACTCTGATCAAAATTTTCACC -3'
(R):5'- CTCCTGAGTCCAGACTTTT -3'
Posted On 2019-03-29