Incidental Mutation 'R6812:Rnf219'
ID543611
Institutional Source Beutler Lab
Gene Symbol Rnf219
Ensembl Gene ENSMUSG00000022120
Gene Namering finger protein 219
Synonyms2810449K13Rik, 2610206B13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6812 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location104477536-104522645 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104510432 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 40 (V40A)
Ref Sequence ENSEMBL: ENSMUSP00000153932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022716] [ENSMUST00000227640] [ENSMUST00000228210] [ENSMUST00000228448]
Predicted Effect silent
Transcript: ENSMUST00000022716
SMART Domains Protein: ENSMUSP00000022716
Gene: ENSMUSG00000022120

DomainStartEndE-ValueType
RING 18 55 2.78e-3 SMART
coiled coil region 87 129 N/A INTRINSIC
coiled coil region 157 263 N/A INTRINSIC
low complexity region 302 319 N/A INTRINSIC
low complexity region 647 658 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000227640
Predicted Effect unknown
Transcript: ENSMUST00000228210
AA Change: V40A
Predicted Effect silent
Transcript: ENSMUST00000228448
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 97.4%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 C T 16: 56,795,798 probably benign Het
Ak9 A T 10: 41,367,167 M686L unknown Het
Ap3b1 A T 13: 94,479,861 T757S unknown Het
Apob A T 12: 7,983,062 K139N probably damaging Het
Arid4a A G 12: 71,047,263 E270G possibly damaging Het
Atp1a2 A T 1: 172,284,877 C515S probably benign Het
Bicd1 T C 6: 149,409,537 Y37H probably damaging Het
Birc3 T G 9: 7,854,417 D424A probably damaging Het
Ccdc97 A T 7: 25,713,044 F324L probably damaging Het
Crim1 T A 17: 78,315,600 I409N probably damaging Het
Cul7 T A 17: 46,661,409 I1233N probably benign Het
Dcaf1 T C 9: 106,858,069 S739P probably damaging Het
Ddb1 T C 19: 10,622,499 probably null Het
Dennd5b T C 6: 149,081,132 probably benign Het
Dna2 A G 10: 62,959,341 S464G probably benign Het
Dnah9 C T 11: 65,981,329 V2692M probably damaging Het
Dvl2 T C 11: 70,000,995 Y55H probably damaging Het
Eif4g3 G T 4: 138,103,376 Q140H probably damaging Het
Enpp5 G A 17: 44,085,576 V460M probably benign Het
Etv2 G T 7: 30,634,001 C265* probably null Het
F12 T C 13: 55,421,845 E146G probably damaging Het
Fdps C A 3: 89,094,476 E301D possibly damaging Het
Fsd2 G T 7: 81,535,089 H686Q probably benign Het
Gk5 T C 9: 96,150,749 S262P probably damaging Het
Gm20730 A G 6: 43,081,788 V30A probably benign Het
Gpr68 C A 12: 100,878,411 E291D probably damaging Het
Gucy2c A G 6: 136,697,995 V1006A probably benign Het
Itgb1 T A 8: 128,705,410 probably null Het
Kif2a A T 13: 106,969,751 D570E probably benign Het
Krt8 G T 15: 101,997,979 A365D probably damaging Het
Lias T A 5: 65,408,789 V373E possibly damaging Het
Mpl A G 4: 118,455,264 V169A probably benign Het
Myh3 T A 11: 67,086,402 I319N probably damaging Het
Myrfl T A 10: 116,832,913 K315I probably damaging Het
Nrap T C 19: 56,351,676 D803G probably damaging Het
Olfr1475 T C 19: 13,479,611 T196A probably benign Het
Pald1 A G 10: 61,342,922 S536P possibly damaging Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Prkaa2 T A 4: 105,047,152 T243S probably benign Het
Prrc2b T A 2: 32,213,141 V877D probably benign Het
Rbm27 T A 18: 42,333,403 probably null Het
Rbm48 A G 5: 3,596,105 V33A probably benign Het
Rev3l G T 10: 39,823,548 R1347L probably benign Het
Rtp3 A G 9: 110,987,112 F124L probably benign Het
Ryr3 C T 2: 112,946,906 G302D probably damaging Het
Scnn1a A G 6: 125,337,856 N314S probably benign Het
Sik3 C T 9: 46,210,769 R907W probably damaging Het
Sox5 C T 6: 144,116,443 probably null Het
Tmc1 A C 19: 20,900,861 L90R probably damaging Het
Tmtc2 A G 10: 105,413,269 V201A probably benign Het
Uvrag T A 7: 98,888,482 H502L probably benign Het
Vwa8 T A 14: 79,197,419 I1760N probably damaging Het
Zfp318 G GAAGAAT 17: 46,412,542 probably benign Het
Zfp772 T C 7: 7,206,308 D61G possibly damaging Het
Other mutations in Rnf219
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Rnf219 APN 14 104479387 nonsense probably null
IGL01731:Rnf219 APN 14 104479302 missense probably damaging 1.00
I2505:Rnf219 UTSW 14 104503449 splice site probably benign
IGL03098:Rnf219 UTSW 14 104478817 missense possibly damaging 0.93
PIT4651001:Rnf219 UTSW 14 104506256 missense probably damaging 0.99
R0047:Rnf219 UTSW 14 104503344 splice site probably null
R0047:Rnf219 UTSW 14 104503344 splice site probably null
R0394:Rnf219 UTSW 14 104478853 missense possibly damaging 0.74
R0608:Rnf219 UTSW 14 104479527 missense probably damaging 1.00
R0727:Rnf219 UTSW 14 104480188 missense probably damaging 1.00
R1109:Rnf219 UTSW 14 104479764 nonsense probably null
R1774:Rnf219 UTSW 14 104479662 missense possibly damaging 0.68
R1922:Rnf219 UTSW 14 104479186 missense probably benign 0.02
R2018:Rnf219 UTSW 14 104522542 missense probably damaging 1.00
R2061:Rnf219 UTSW 14 104522532 splice site probably benign
R2182:Rnf219 UTSW 14 104506176 missense possibly damaging 0.55
R2336:Rnf219 UTSW 14 104478882 missense probably damaging 1.00
R4308:Rnf219 UTSW 14 104479593 missense probably damaging 0.97
R4355:Rnf219 UTSW 14 104479257 missense probably benign 0.01
R4703:Rnf219 UTSW 14 104506208 missense probably benign 0.03
R4738:Rnf219 UTSW 14 104510383 missense probably damaging 1.00
R4739:Rnf219 UTSW 14 104510383 missense probably damaging 1.00
R4869:Rnf219 UTSW 14 104478816 missense probably damaging 0.99
R5025:Rnf219 UTSW 14 104508030 missense probably damaging 1.00
R5054:Rnf219 UTSW 14 104508030 missense probably damaging 1.00
R5167:Rnf219 UTSW 14 104478787 missense probably damaging 1.00
R6356:Rnf219 UTSW 14 104478877 missense probably damaging 0.99
R6427:Rnf219 UTSW 14 104480226 missense possibly damaging 0.70
R6482:Rnf219 UTSW 14 104479817 nonsense probably null
R6518:Rnf219 UTSW 14 104479065 missense probably damaging 1.00
R6619:Rnf219 UTSW 14 104522557 missense possibly damaging 0.88
R6731:Rnf219 UTSW 14 104479474 missense probably benign 0.06
R6754:Rnf219 UTSW 14 104503414 missense probably damaging 1.00
R7225:Rnf219 UTSW 14 104479858 missense probably benign 0.00
R7567:Rnf219 UTSW 14 104479378 missense probably damaging 1.00
X0002:Rnf219 UTSW 14 104507977 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGATCCTTCACAGTCTAC -3'
(R):5'- GTCTGCTCGCATCTTTGACATATG -3'

Sequencing Primer
(F):5'- TGAGAACTTTATATCACTCTTCTCCC -3'
(R):5'- TCGCATCTTTGACATATGAGAAATAG -3'
Posted On2019-03-29