Incidental Mutation 'R6744:Cdc73'
ID543613
Institutional Source Beutler Lab
Gene Symbol Cdc73
Ensembl Gene ENSMUSG00000026361
Gene Namecell division cycle 73, Paf1/RNA polymerase II complex component
SynonymsHrpt2, 8430414L16Rik, C130030P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6744 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location143598800-143702893 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 143702149 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000018337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018337] [ENSMUST00000159794]
Predicted Effect probably benign
Transcript: ENSMUST00000018337
SMART Domains Protein: ENSMUSP00000018337
Gene: ENSMUSG00000026361

DomainStartEndE-ValueType
Pfam:CDC73_N 1 297 3.4e-135 PFAM
Pfam:CDC73_C 356 521 2.6e-53 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159794
AA Change: R18W
SMART Domains Protein: ENSMUSP00000139872
Gene: ENSMUSG00000026361
AA Change: R18W

DomainStartEndE-ValueType
low complexity region 36 44 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone methyltransferase complex. This protein appears to facilitate the association of 3' mRNA processing factors with actively-transcribed chromatin. Mutations in this gene have been linked to hyperparathyroidism-jaw tumor syndrome, familial isolated hyperparathyroidism, and parathyroid carcinoma. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality around hatching or implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T A 10: 20,965,567 L251H probably damaging Het
Alk A T 17: 72,603,082 S210T probably benign Het
Arap2 A G 5: 62,748,938 F246S probably damaging Het
Atad5 T A 11: 80,134,032 N1749K probably benign Het
C130060K24Rik T A 6: 65,441,340 M164K possibly damaging Het
C87436 T A 6: 86,446,064 S207T probably damaging Het
C8b C T 4: 104,774,346 R53W probably damaging Het
Catsperg2 A G 7: 29,709,819 V619A probably benign Het
Cdh4 C A 2: 179,847,387 H297Q possibly damaging Het
Col3a1 G T 1: 45,338,622 probably benign Het
Crybg2 A G 4: 134,088,896 N1328S probably damaging Het
Ctnnb1 T A 9: 120,952,959 V346E probably damaging Het
Ctns C T 11: 73,185,285 G308E probably damaging Het
Cxxc4 AGGCGGCGGCGGCGGCGGCGGCGGC AGGCGGCGGCGGCGGCGGCGGCGGCGGC 3: 134,240,130 probably benign Het
Dnah6 A G 6: 73,037,549 I3685T probably damaging Het
Dock6 T C 9: 21,831,474 H775R probably damaging Het
Fbxl3 A T 14: 103,083,294 V239D probably damaging Het
Gh T A 11: 106,301,404 K55* probably null Het
Gm49333 A T 16: 20,630,366 K165N probably damaging Het
Havcr2 T G 11: 46,455,060 probably null Het
Kcnq2 T A 2: 181,085,306 H576L possibly damaging Het
Kifap3 A G 1: 163,848,670 N398S probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Mblac1 A G 5: 138,194,420 E8G possibly damaging Het
Mtor C T 4: 148,458,655 T290I probably benign Het
Nceh1 T C 3: 27,241,789 Y400H probably damaging Het
Nek9 A G 12: 85,329,929 V226A probably benign Het
Olfr119 T A 17: 37,701,445 Y258* probably null Het
Olfr518 T C 7: 108,880,830 T259A probably damaging Het
Olfr710 A G 7: 106,944,534 S156P probably damaging Het
Otud4 C A 8: 79,673,778 Y1039* probably null Het
Pax4 T C 6: 28,442,397 H331R probably benign Het
Piezo2 A T 18: 63,032,889 Y2090* probably null Het
Ppp1r12a T A 10: 108,230,534 H195Q probably damaging Het
Ppp6r2 A G 15: 89,256,661 probably null Het
Prodh A G 16: 18,079,200 V23A probably benign Het
Psg20 G A 7: 18,674,580 T405I probably damaging Het
Ptprf T C 4: 118,236,365 D360G probably benign Het
Rad18 A T 6: 112,675,784 M284K probably damaging Het
Rgs17 T C 10: 5,842,567 K60E possibly damaging Het
Sec31a G T 5: 100,392,499 Q39K possibly damaging Het
Slc22a22 G T 15: 57,254,272 T291K possibly damaging Het
Sult2a6 C T 7: 14,222,545 E264K probably damaging Het
Syne2 C T 12: 76,074,447 R5896C probably damaging Het
Tctn1 A T 5: 122,264,146 V75D probably damaging Het
Tmem214 A G 5: 30,874,028 K409E probably damaging Het
Vcan T C 13: 89,705,182 Y553C probably damaging Het
Vmn1r49 C T 6: 90,072,202 V273I probably benign Het
Other mutations in Cdc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Cdc73 APN 1 143671332 missense probably benign 0.10
IGL01598:Cdc73 APN 1 143699279 missense probably damaging 1.00
R0648:Cdc73 UTSW 1 143695462 missense probably benign 0.00
R1299:Cdc73 UTSW 1 143699281 missense probably benign 0.00
R1342:Cdc73 UTSW 1 143702492 critical splice donor site probably null
R1411:Cdc73 UTSW 1 143609514 splice site probably benign
R1837:Cdc73 UTSW 1 143667657 missense possibly damaging 0.46
R2208:Cdc73 UTSW 1 143609382 missense probably damaging 1.00
R3721:Cdc73 UTSW 1 143695453 missense possibly damaging 0.77
R3797:Cdc73 UTSW 1 143677723 missense probably benign 0.22
R4088:Cdc73 UTSW 1 143608514 utr 3 prime probably benign
R4603:Cdc73 UTSW 1 143677857 critical splice acceptor site probably null
R4782:Cdc73 UTSW 1 143627875 missense probably benign 0.10
R4799:Cdc73 UTSW 1 143627875 missense probably benign 0.10
R5512:Cdc73 UTSW 1 143702616 missense probably damaging 1.00
R5801:Cdc73 UTSW 1 143608543 missense probably benign 0.01
R6006:Cdc73 UTSW 1 143617439 missense probably damaging 1.00
R6258:Cdc73 UTSW 1 143691473 missense probably benign 0.32
R6260:Cdc73 UTSW 1 143691473 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- ACCCCTCTTGAGGAATAACATC -3'
(R):5'- GCGACCTCTTTCCCTAAAGC -3'

Sequencing Primer
(F):5'- TCTTGAGGAATAACATCAACCTACC -3'
(R):5'- GCTCTGGGGAAAAAGTTATTCTC -3'
Posted On2019-04-01