Incidental Mutation 'R6720:Serpinb13'
ID543615
Institutional Source Beutler Lab
Gene Symbol Serpinb13
Ensembl Gene ENSMUSG00000048775
Gene Nameserine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13
SynonymsHURPIN, headpin, HUR7, PI13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6720 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location106980984-107001195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106994062 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 78 (I78V)
Ref Sequence ENSEMBL: ENSMUSP00000118572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]
Predicted Effect probably benign
Transcript: ENSMUST00000027564
SMART Domains Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775

DomainStartEndE-ValueType
SERPIN 13 389 1.55e-144 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136766
AA Change: I78V

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775
AA Change: I78V

DomainStartEndE-ValueType
Pfam:Serpin 6 94 1.1e-16 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Serpinb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Serpinb13 APN 1 106996380 missense probably damaging 1.00
IGL01758:Serpinb13 APN 1 107000754 missense probably damaging 1.00
IGL02078:Serpinb13 APN 1 106998958 missense probably damaging 0.99
IGL02183:Serpinb13 APN 1 106998910 missense probably damaging 1.00
PIT4651001:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R0683:Serpinb13 UTSW 1 106999021 missense probably damaging 1.00
R1263:Serpinb13 UTSW 1 107000736 missense probably damaging 0.97
R1535:Serpinb13 UTSW 1 106982156 start codon destroyed probably null 1.00
R1929:Serpinb13 UTSW 1 106999026 missense possibly damaging 0.85
R2271:Serpinb13 UTSW 1 106999026 missense possibly damaging 0.85
R2655:Serpinb13 UTSW 1 107000427 missense probably damaging 0.99
R3115:Serpinb13 UTSW 1 106982838 missense probably null 0.15
R3418:Serpinb13 UTSW 1 106998927 missense probably damaging 0.99
R3419:Serpinb13 UTSW 1 106998927 missense probably damaging 0.99
R3883:Serpinb13 UTSW 1 106998572 missense probably benign 0.37
R4664:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4666:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4689:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4690:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4725:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4728:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4847:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R5249:Serpinb13 UTSW 1 106998697 missense probably damaging 1.00
R5501:Serpinb13 UTSW 1 106982185 missense possibly damaging 0.81
R5507:Serpinb13 UTSW 1 106998602 missense probably benign 0.00
R6015:Serpinb13 UTSW 1 107000607 missense probably benign 0.00
R6363:Serpinb13 UTSW 1 107000774 nonsense probably null
R6847:Serpinb13 UTSW 1 106998933 missense probably benign 0.24
R7237:Serpinb13 UTSW 1 106998949 missense probably damaging 1.00
Z1177:Serpinb13 UTSW 1 106982303 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCCCTCTGTCAGATATAGGGTTG -3'
(R):5'- TACATGGAGGATCTCAGGCCTTG -3'

Sequencing Primer
(F):5'- GAAGAACTTTTCTCATCCTGTAGGC -3'
(R):5'- GATCTCAGGCCTTGAAAACATG -3'
Posted On2019-04-01