Incidental Mutation 'R6720:Serpinb13'
ID 543615
Institutional Source Beutler Lab
Gene Symbol Serpinb13
Ensembl Gene ENSMUSG00000048775
Gene Name serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13
Synonyms HUR7, HURPIN, PI13, headpin
MMRRC Submission 044838-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6720 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 106908714-106928925 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106921792 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 78 (I78V)
Ref Sequence ENSEMBL: ENSMUSP00000118572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]
AlphaFold Q8CDC0
Predicted Effect probably benign
Transcript: ENSMUST00000027564
SMART Domains Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775

DomainStartEndE-ValueType
SERPIN 13 389 1.55e-144 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136766
AA Change: I78V

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775
AA Change: I78V

DomainStartEndE-ValueType
Pfam:Serpin 6 94 1.1e-16 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,181,997 (GRCm39) E51K possibly damaging Het
Abca1 A C 4: 53,083,733 (GRCm39) L700R probably damaging Het
Arpc1a C A 5: 145,038,032 (GRCm39) probably null Het
Baz2b G T 2: 59,755,234 (GRCm39) P241Q probably damaging Het
Cd6 T A 19: 10,771,973 (GRCm39) T414S probably benign Het
Ces2b A T 8: 105,563,501 (GRCm39) E409D probably benign Het
Cfap54 A G 10: 92,656,981 (GRCm39) Y3024H probably benign Het
Chrm1 A G 19: 8,655,912 (GRCm39) T206A probably benign Het
Clptm1l T C 13: 73,766,635 (GRCm39) W512R probably damaging Het
Col15a1 T A 4: 47,247,552 (GRCm39) probably null Het
Cox15 A G 19: 43,725,228 (GRCm39) S392P probably damaging Het
Cplx3 A G 9: 57,521,355 (GRCm39) probably null Het
Cr2 T C 1: 194,837,508 (GRCm39) M1197V probably damaging Het
Ddx60 A G 8: 62,453,723 (GRCm39) K1281E probably benign Het
Dnah11 A G 12: 118,009,381 (GRCm39) F2094L probably damaging Het
Ear2 T A 14: 44,340,416 (GRCm39) C25S probably damaging Het
Ect2l T C 10: 18,016,012 (GRCm39) D802G probably damaging Het
Eftud2 G A 11: 102,729,449 (GRCm39) Q84* probably null Het
Eif4g3 T A 4: 137,903,143 (GRCm39) probably null Het
Ephb2 T C 4: 136,384,813 (GRCm39) D866G probably damaging Het
Farsb A G 1: 78,449,134 (GRCm39) M99T probably damaging Het
Foxs1 T A 2: 152,774,640 (GRCm39) S138C probably damaging Het
Frem1 T G 4: 82,932,069 (GRCm39) S211R probably damaging Het
Gm19410 G A 8: 36,274,730 (GRCm39) R1517Q probably benign Het
Gria2 T C 3: 80,709,611 (GRCm39) I27M probably benign Het
H2-Q7 A G 17: 35,661,654 (GRCm39) E299G probably benign Het
Hao2 T G 3: 98,784,451 (GRCm39) I305L probably benign Het
Hectd4 C T 5: 121,445,444 (GRCm39) Q122* probably null Het
Hivep1 T A 13: 42,317,760 (GRCm39) C2079S probably damaging Het
Hoxb1 C A 11: 96,257,813 (GRCm39) Q248K probably damaging Het
Hspb6 A G 7: 30,253,772 (GRCm39) D95G probably benign Het
Ighv5-2 T A 12: 113,542,126 (GRCm39) R117S probably damaging Het
Ino80d A C 1: 63,097,769 (GRCm39) S708R probably damaging Het
Mmp15 A G 8: 96,091,942 (GRCm39) N51D probably benign Het
Naip1 T C 13: 100,559,585 (GRCm39) M1140V probably benign Het
Niban2 T A 2: 32,795,838 (GRCm39) V22D probably damaging Het
Or1e1f A G 11: 73,856,291 (GRCm39) N286D probably damaging Het
Or2y8 A G 11: 52,035,520 (GRCm39) V279A probably benign Het
Or8b41 T A 9: 38,054,449 (GRCm39) M1K probably null Het
Or8k21 A G 2: 86,145,409 (GRCm39) S74P probably damaging Het
Pard3b A T 1: 62,198,629 (GRCm39) N239I probably damaging Het
Parvb C T 15: 84,182,180 (GRCm39) R237W probably damaging Het
Pcdha9 T C 18: 37,131,122 (GRCm39) S64P probably damaging Het
Pdcd1 T C 1: 93,969,114 (GRCm39) N68S probably benign Het
Pi4ka G T 16: 17,143,916 (GRCm39) probably null Het
Plekha4 A T 7: 45,190,310 (GRCm39) D359V possibly damaging Het
Slc39a7 T A 17: 34,249,082 (GRCm39) T269S probably benign Het
Sltm T G 9: 70,480,992 (GRCm39) D281E probably damaging Het
Zfp708 T C 13: 67,219,496 (GRCm39) Y76C probably damaging Het
Zfp990 T A 4: 145,263,497 (GRCm39) V165D possibly damaging Het
Other mutations in Serpinb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Serpinb13 APN 1 106,924,110 (GRCm39) missense probably damaging 1.00
IGL01758:Serpinb13 APN 1 106,928,484 (GRCm39) missense probably damaging 1.00
IGL02078:Serpinb13 APN 1 106,926,688 (GRCm39) missense probably damaging 0.99
IGL02183:Serpinb13 APN 1 106,926,640 (GRCm39) missense probably damaging 1.00
PIT4651001:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R0683:Serpinb13 UTSW 1 106,926,751 (GRCm39) missense probably damaging 1.00
R1263:Serpinb13 UTSW 1 106,928,466 (GRCm39) missense probably damaging 0.97
R1535:Serpinb13 UTSW 1 106,909,886 (GRCm39) start codon destroyed probably null 1.00
R1929:Serpinb13 UTSW 1 106,926,756 (GRCm39) missense possibly damaging 0.85
R2271:Serpinb13 UTSW 1 106,926,756 (GRCm39) missense possibly damaging 0.85
R2655:Serpinb13 UTSW 1 106,928,157 (GRCm39) missense probably damaging 0.99
R3115:Serpinb13 UTSW 1 106,910,568 (GRCm39) missense probably null 0.15
R3418:Serpinb13 UTSW 1 106,926,657 (GRCm39) missense probably damaging 0.99
R3419:Serpinb13 UTSW 1 106,926,657 (GRCm39) missense probably damaging 0.99
R3883:Serpinb13 UTSW 1 106,926,302 (GRCm39) missense probably benign 0.37
R4664:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4666:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4689:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4690:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4725:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4728:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4847:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R5249:Serpinb13 UTSW 1 106,926,427 (GRCm39) missense probably damaging 1.00
R5501:Serpinb13 UTSW 1 106,909,915 (GRCm39) missense possibly damaging 0.81
R5507:Serpinb13 UTSW 1 106,926,332 (GRCm39) missense probably benign 0.00
R6015:Serpinb13 UTSW 1 106,928,337 (GRCm39) missense probably benign 0.00
R6363:Serpinb13 UTSW 1 106,928,504 (GRCm39) nonsense probably null
R6847:Serpinb13 UTSW 1 106,926,663 (GRCm39) missense probably benign 0.24
R7237:Serpinb13 UTSW 1 106,926,679 (GRCm39) missense probably damaging 1.00
R8907:Serpinb13 UTSW 1 106,928,519 (GRCm39) missense probably damaging 1.00
R8966:Serpinb13 UTSW 1 106,928,165 (GRCm39) missense probably damaging 1.00
R9011:Serpinb13 UTSW 1 106,923,519 (GRCm39) missense probably benign 0.01
R9350:Serpinb13 UTSW 1 106,923,562 (GRCm39) nonsense probably null
R9375:Serpinb13 UTSW 1 106,909,997 (GRCm39) missense probably damaging 1.00
R9774:Serpinb13 UTSW 1 106,923,579 (GRCm39) missense probably benign 0.02
Z1177:Serpinb13 UTSW 1 106,910,033 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCCCTCTGTCAGATATAGGGTTG -3'
(R):5'- TACATGGAGGATCTCAGGCCTTG -3'

Sequencing Primer
(F):5'- GAAGAACTTTTCTCATCCTGTAGGC -3'
(R):5'- GATCTCAGGCCTTGAAAACATG -3'
Posted On 2019-04-01