Mutagenetix > Incidental Mutation

Incidental Mutation 'R6720:Serpinb13'

543615

Institutional Source

Beutler Lab

Gene Symbol

Serpinb13

Ensembl Gene

ENSMUSG00000048775

Gene Name

serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13

Synonyms

HURPIN, headpin, HUR7, PI13

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R6720 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106980984-107001195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106994062 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 78 (I78V)

Ref Sequence

ENSEMBL: ENSMUSP00000118572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]

AlphaFold

Q8CDC0

Predicted Effect

probably benign
Transcript: ENSMUST00000027564

SMART Domains

Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775

Domain	Start	End	E-Value	Type
SERPIN	13	389	1.55e-144	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000136766
AA Change: I78V

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775
AA Change: I78V

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	94	1.1e-16	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.6%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	G	A	4: 137,454,686	E51K	possibly damaging	Het
Abca1	A	C	4: 53,083,733	L700R	probably damaging	Het
Arpc1a	C	A	5: 145,101,222		probably null	Het
Baz2b	G	T	2: 59,924,890	P241Q	probably damaging	Het
Cd6	T	A	19: 10,794,609	T414S	probably benign	Het
Ces2b	A	T	8: 104,836,869	E409D	probably benign	Het
Cfap54	A	G	10: 92,821,119	Y3024H	probably benign	Het
Chrm1	A	G	19: 8,678,548	T206A	probably benign	Het
Clptm1l	T	C	13: 73,618,516	W512R	probably damaging	Het
Col15a1	T	A	4: 47,247,552		probably null	Het
Cox15	A	G	19: 43,736,789	S392P	probably damaging	Het
Cr2	T	C	1: 195,155,200	M1197V	probably damaging	Het
Ddx60	A	G	8: 62,000,689	K1281E	probably benign	Het
Dnah11	A	G	12: 118,045,646	F2094L	probably damaging	Het
Ear2	T	A	14: 44,102,959	C25S	probably damaging	Het
Ect2l	T	C	10: 18,140,264	D802G	probably damaging	Het
Eftud2	G	A	11: 102,838,623	Q84*	probably null	Het
Eif4g3	T	A	4: 138,175,832		probably null	Het
Ephb2	T	C	4: 136,657,502	D866G	probably damaging	Het
Fam129b	T	A	2: 32,905,826	V22D	probably damaging	Het
Farsb	A	G	1: 78,472,497	M99T	probably damaging	Het
Foxs1	T	A	2: 152,932,720	S138C	probably damaging	Het
Frem1	T	G	4: 83,013,832	S211R	probably damaging	Het
Gm19410	G	A	8: 35,807,576	R1517Q	probably benign	Het
Gria2	T	C	3: 80,802,304	I27M	probably benign	Het
H2-Q7	A	G	17: 35,442,678	E299G	probably benign	Het
Hao2	T	G	3: 98,877,135	I305L	probably benign	Het
Hectd4	C	T	5: 121,307,381	Q122*	probably null	Het
Hivep1	T	A	13: 42,164,284	C2079S	probably damaging	Het
Hoxb1	C	A	11: 96,366,987	Q248K	probably damaging	Het
Hspb6	A	G	7: 30,554,347	D95G	probably benign	Het
Ighv5-2	T	A	12: 113,578,506	R117S	probably damaging	Het
Ino80d	A	C	1: 63,058,610	S708R	probably damaging	Het
Lman1l	A	G	9: 57,614,072		probably null	Het
Mmp15	A	G	8: 95,365,314	N51D	probably benign	Het
Naip1	T	C	13: 100,423,077	M1140V	probably benign	Het
Olfr1053	A	G	2: 86,315,065	S74P	probably damaging	Het
Olfr1373	A	G	11: 52,144,693	V279A	probably benign	Het
Olfr397	A	G	11: 73,965,465	N286D	probably damaging	Het
Olfr890	T	A	9: 38,143,153	M1K	probably null	Het
Pard3b	A	T	1: 62,159,470	N239I	probably damaging	Het
Parvb	C	T	15: 84,297,979	R237W	probably damaging	Het
Pcdha9	T	C	18: 36,998,069	S64P	probably damaging	Het
Pdcd1	T	C	1: 94,041,389	N68S	probably benign	Het
Pi4ka	G	T	16: 17,326,052		probably null	Het
Plekha4	A	T	7: 45,540,886	D359V	possibly damaging	Het
Slc39a7	T	A	17: 34,030,108	T269S	probably benign	Het
Sltm	T	G	9: 70,573,710	D281E	probably damaging	Het
Zfp708	T	C	13: 67,071,432	Y76C	probably damaging	Het
Zfp990	T	A	4: 145,536,927	V165D	possibly damaging	Het

Other mutations in Serpinb13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Serpinb13	APN	1	106996380	missense	probably damaging	1.00
IGL01758:Serpinb13	APN	1	107000754	missense	probably damaging	1.00
IGL02078:Serpinb13	APN	1	106998958	missense	probably damaging	0.99
IGL02183:Serpinb13	APN	1	106998910	missense	probably damaging	1.00
PIT4651001:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R0683:Serpinb13	UTSW	1	106999021	missense	probably damaging	1.00
R1263:Serpinb13	UTSW	1	107000736	missense	probably damaging	0.97
R1535:Serpinb13	UTSW	1	106982156	start codon destroyed	probably null	1.00
R1929:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2271:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2655:Serpinb13	UTSW	1	107000427	missense	probably damaging	0.99
R3115:Serpinb13	UTSW	1	106982838	missense	probably null	0.15
R3418:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3419:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3883:Serpinb13	UTSW	1	106998572	missense	probably benign	0.37
R4664:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4666:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4689:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4690:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4725:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4728:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4847:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R5249:Serpinb13	UTSW	1	106998697	missense	probably damaging	1.00
R5501:Serpinb13	UTSW	1	106982185	missense	possibly damaging	0.81
R5507:Serpinb13	UTSW	1	106998602	missense	probably benign	0.00
R6015:Serpinb13	UTSW	1	107000607	missense	probably benign	0.00
R6363:Serpinb13	UTSW	1	107000774	nonsense	probably null
R6847:Serpinb13	UTSW	1	106998933	missense	probably benign	0.24
R7237:Serpinb13	UTSW	1	106998949	missense	probably damaging	1.00
R8907:Serpinb13	UTSW	1	107000789	missense	probably damaging	1.00
R8966:Serpinb13	UTSW	1	107000435	missense	probably damaging	1.00
R9011:Serpinb13	UTSW	1	106995789	missense	probably benign	0.01
R9350:Serpinb13	UTSW	1	106995832	nonsense	probably null
R9375:Serpinb13	UTSW	1	106982267	missense	probably damaging	1.00
R9774:Serpinb13	UTSW	1	106995849	missense	probably benign	0.02
Z1177:Serpinb13	UTSW	1	106982303	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AGCCCTCTGTCAGATATAGGGTTG -3'
(R):5'- TACATGGAGGATCTCAGGCCTTG -3'

Sequencing Primer
(F):5'- GAAGAACTTTTCTCATCCTGTAGGC -3'
(R):5'- GATCTCAGGCCTTGAAAACATG -3'

Posted On

2019-04-01