Incidental Mutation 'R6769:Gm7361'
ID543624
Institutional Source Beutler Lab
Gene Symbol Gm7361
Ensembl Gene ENSMUSG00000059645
Gene Namepredicted gene 7361
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6769 (G1)
Quality Score40.0075
Status Validated
Chromosome5
Chromosomal Location26257691-26264308 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 26257769 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 3 (L3*)
Ref Sequence ENSEMBL: ENSMUSP00000073781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074148]
Predicted Effect probably null
Transcript: ENSMUST00000074148
AA Change: L3*
SMART Domains Protein: ENSMUSP00000073781
Gene: ENSMUSG00000059645
AA Change: L3*

DomainStartEndE-ValueType
Pfam:Takusan 50 134 2.1e-26 PFAM
low complexity region 154 168 N/A INTRINSIC
low complexity region 235 259 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,461,461 H174Q probably damaging Het
Alox5 C A 6: 116,415,184 probably null Het
Amer3 C A 1: 34,588,249 A523D possibly damaging Het
Apoa4 G A 9: 46,243,167 M355I probably benign Het
Atp10b T C 11: 43,203,252 probably null Het
Atp9a A T 2: 168,674,900 Y340N probably damaging Het
C1rb T G 6: 124,577,405 S382A probably benign Het
Csmd1 A G 8: 16,071,394 V1763A possibly damaging Het
Ctnnd1 C A 2: 84,619,925 R317L probably damaging Het
Ctnnd1 A T 2: 84,620,110 D255E probably damaging Het
Dmxl2 A T 9: 54,416,524 I1192N probably damaging Het
Efcab5 A G 11: 77,105,432 V1101A probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam129b C T 2: 32,895,654 Het
Fam69b A G 2: 26,634,863 R92G probably benign Het
Flg T C 3: 93,288,323 probably benign Het
Fras1 A G 5: 96,598,941 I623M possibly damaging Het
Gpr35 T A 1: 92,982,704 M46K probably damaging Het
Ighv2-9 A T 12: 113,879,310 F46I possibly damaging Het
Kdm4b C T 17: 56,351,754 A33V possibly damaging Het
Klhl5 T A 5: 65,164,652 Y534N probably damaging Het
Mccc1 C T 3: 35,989,843 probably null Het
Memo1 A T 17: 74,201,278 F270L probably damaging Het
Mnat1 A G 12: 73,272,422 N273S probably benign Het
Nxpe3 C A 16: 55,866,108 G179V probably damaging Het
Olfr1477 T A 19: 13,502,954 F204I possibly damaging Het
Otp A G 13: 94,875,786 D6G probably damaging Het
Prdm5 T A 6: 65,862,936 I265K probably damaging Het
Ptpn4 T A 1: 119,715,968 N350I probably benign Het
Rassf10 A G 7: 112,954,428 M79V probably benign Het
Rassf4 T A 6: 116,641,472 D215V possibly damaging Het
Rbm12 A T 2: 156,097,455 I299N possibly damaging Het
Scfd2 T C 5: 74,531,456 H55R probably benign Het
Scn8a A G 15: 101,035,564 N1550D probably benign Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc30a5 A C 13: 100,813,860 S240A probably benign Het
Slc7a4 A G 16: 17,575,320 V205A possibly damaging Het
Syde2 G A 3: 145,999,048 G318E probably damaging Het
Ttn T A 2: 76,708,539 D34649V possibly damaging Het
Vmn2r83 T A 10: 79,478,022 S155T probably damaging Het
Other mutations in Gm7361
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02447:Gm7361 APN 5 26257855 missense probably benign
IGL02550:Gm7361 APN 5 26261122 missense possibly damaging 0.79
R0011:Gm7361 UTSW 5 26258878 splice site probably benign
R0959:Gm7361 UTSW 5 26262053 missense possibly damaging 0.86
R1246:Gm7361 UTSW 5 26261227 nonsense probably null
R1580:Gm7361 UTSW 5 26257770 missense probably damaging 0.97
R1654:Gm7361 UTSW 5 26261099 missense probably damaging 0.99
R2065:Gm7361 UTSW 5 26262151 missense probably damaging 1.00
R4864:Gm7361 UTSW 5 26262010 critical splice acceptor site probably null
R5386:Gm7361 UTSW 5 26258905 missense probably benign
R6282:Gm7361 UTSW 5 26260413 missense probably benign 0.13
R6391:Gm7361 UTSW 5 26258962 missense probably benign 0.37
R7205:Gm7361 UTSW 5 26261118 missense probably damaging 0.99
R7497:Gm7361 UTSW 5 26261190 missense probably benign
R7498:Gm7361 UTSW 5 26261190 missense probably benign
R7499:Gm7361 UTSW 5 26261190 missense probably benign
Z1177:Gm7361 UTSW 5 26261188 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAGGGCAGCTCAGCTTACTG -3'
(R):5'- TCCACATTACTGGAAAGGCC -3'

Sequencing Primer
(F):5'- AGCTCAGCTTACTGTCAGTACAGG -3'
(R):5'- AGGCCAGCTCAGGTAACC -3'
Posted On2019-04-04