Incidental Mutation 'R6895:Nmbr'
ID543632
Institutional Source Beutler Lab
Gene Symbol Nmbr
Ensembl Gene ENSMUSG00000019865
Gene Nameneuromedin B receptor
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_008703

Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6895 (G1)
Quality Score122.008
Status Validated
Chromosome10
Chromosomal Location14705591-14770850 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to T at 14769960 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tyrosine at position 258 (*258Y)
Ref Sequence ENSEMBL: ENSMUSP00000139612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020015] [ENSMUST00000186382] [ENSMUST00000190114] [ENSMUST00000190751] [ENSMUST00000191238]
Predicted Effect probably benign
Transcript: ENSMUST00000020015
SMART Domains Protein: ENSMUSP00000020015
Gene: ENSMUSG00000019865

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 54 339 5.9e-9 PFAM
Pfam:7tm_1 60 325 2.9e-55 PFAM
Pfam:7TM_GPCR_Srv 92 341 2.6e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000186382
AA Change: *258Y
SMART Domains Protein: ENSMUSP00000139612
Gene: ENSMUSG00000019865
AA Change: *258Y

DomainStartEndE-ValueType
Pfam:7tm_1 60 257 1.4e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190114
SMART Domains Protein: ENSMUSP00000140754
Gene: ENSMUSG00000019865

DomainStartEndE-ValueType
Pfam:7tm_1 8 119 6.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190751
SMART Domains Protein: ENSMUSP00000140223
Gene: ENSMUSG00000019865

DomainStartEndE-ValueType
Pfam:7tm_1 60 144 2.7e-21 PFAM
transmembrane domain 152 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191238
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 7-transmembrane G protein-coupled receptor that binds neuromedin B, which is a growth factor and mitogen for gastrointestinal epithelial tissue and for normal and neoplastic lung. This receptor may play a role in smooth muscle contraction, neuronal responses, and the regulation of cell growth. Antagonists of this receptor have a potential therapeutic use in inhibiting tumor cell growth. Polymorphisms in this gene may be associated with a susceptibility for schizophrenia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele show a 50% reduction in the thermoregulatory response to neuromedin B as well as impaired maternal behavior in response to restraint-induced stress. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Nmbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Nmbr APN 10 14770429 missense probably benign 0.19
IGL01874:Nmbr APN 10 14766952 missense probably benign 0.09
IGL02616:Nmbr APN 10 14760687 intron probably benign
IGL02619:Nmbr APN 10 14760587 missense probably damaging 0.99
IGL03015:Nmbr APN 10 14760668 missense probably damaging 1.00
G5030:Nmbr UTSW 10 14767003 missense possibly damaging 0.95
R0057:Nmbr UTSW 10 14760524 missense probably damaging 0.97
R0238:Nmbr UTSW 10 14770395 nonsense probably null
R0238:Nmbr UTSW 10 14770395 nonsense probably null
R0324:Nmbr UTSW 10 14760448 missense possibly damaging 0.50
R1252:Nmbr UTSW 10 14760443 missense probably benign 0.09
R1812:Nmbr UTSW 10 14760539 intron probably null
R1831:Nmbr UTSW 10 14766865 missense probably benign 0.36
R2140:Nmbr UTSW 10 14770442 nonsense probably null
R2141:Nmbr UTSW 10 14770442 nonsense probably null
R4604:Nmbr UTSW 10 14770164 missense probably damaging 1.00
R4936:Nmbr UTSW 10 14766986 missense probably damaging 1.00
R5965:Nmbr UTSW 10 14766810 missense probably benign 0.01
R6636:Nmbr UTSW 10 14770234 missense probably benign 0.23
R7644:Nmbr UTSW 10 14760689 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACTTGTATTAAAGAGGGGCAGAG -3'
(R):5'- CCCACTGGTCAAAAGGAAATGG -3'

Sequencing Primer
(F):5'- AAAATTAGTCCTCTTTCATCAGGTC -3'
(R):5'- CTGGTCAAAAGGAAATGGAGTCATCC -3'
Posted On2019-04-11