Incidental Mutation 'R6813:Dcun1d4'
ID 543634
Institutional Source Beutler Lab
Gene Symbol Dcun1d4
Ensembl Gene ENSMUSG00000051674
Gene Name DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock # R6813 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 73481000-73560794 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 73520957 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 98 (S98R)
Ref Sequence ENSEMBL: ENSMUSP00000120055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063882] [ENSMUST00000087181] [ENSMUST00000113558] [ENSMUST00000133137] [ENSMUST00000134092] [ENSMUST00000136268] [ENSMUST00000141553] [ENSMUST00000145645] [ENSMUST00000156806]
AlphaFold Q8CCA0
Predicted Effect probably benign
Transcript: ENSMUST00000063882
SMART Domains Protein: ENSMUSP00000067616
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Pfam:Cullin_binding 173 287 3.4e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087181
SMART Domains Protein: ENSMUSP00000084427
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Pfam:Cullin_binding 189 300 1.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113558
SMART Domains Protein: ENSMUSP00000109187
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Pfam:Cullin_binding 203 252 2e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133137
AA Change: S98R

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120055
Gene: ENSMUSG00000051674
AA Change: S98R

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134092
SMART Domains Protein: ENSMUSP00000118710
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136268
SMART Domains Protein: ENSMUSP00000119983
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
PDB:4GBA|B 42 104 2e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000141553
Predicted Effect probably benign
Transcript: ENSMUST00000145645
SMART Domains Protein: ENSMUSP00000122689
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
PDB:4GBA|B 42 101 1e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000156806
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Arfgap3 A T 15: 83,330,593 M164K probably benign Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Brsk2 A G 7: 142,002,477 I649V probably benign Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dab2ip C T 2: 35,730,473 Q1118* probably null Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Frmd3 T C 4: 74,159,245 S259P probably benign Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Ifih1 C T 2: 62,645,693 V80M possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Mgam A T 6: 40,750,165 M1257L probably damaging Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myh1 T C 11: 67,220,460 V1575A probably benign Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Ncoa7 T A 10: 30,696,192 D157V probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Olfr980 T A 9: 40,006,457 H164L probably benign Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Phldb1 A T 9: 44,699,568 S751R probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Rasgrf1 G A 9: 90,010,484 probably null Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Tmem33 T C 5: 67,264,459 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Vmn2r96 A G 17: 18,581,854 H119R probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wdr78 T C 4: 103,048,326 K753E probably benign Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Dcun1d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02194:Dcun1d4 APN 5 73481201 splice site probably benign
IGL02345:Dcun1d4 APN 5 73511152 missense probably damaging 0.99
IGL03264:Dcun1d4 APN 5 73520229 missense probably benign 0.00
PIT4402001:Dcun1d4 UTSW 5 73510933 missense probably benign 0.09
R1184:Dcun1d4 UTSW 5 73511112 splice site probably benign
R2266:Dcun1d4 UTSW 5 73481275 splice site probably benign
R2267:Dcun1d4 UTSW 5 73481275 splice site probably benign
R2268:Dcun1d4 UTSW 5 73481275 splice site probably benign
R2269:Dcun1d4 UTSW 5 73481275 splice site probably benign
R4027:Dcun1d4 UTSW 5 73534637 missense probably damaging 0.97
R4029:Dcun1d4 UTSW 5 73534637 missense probably damaging 0.97
R4031:Dcun1d4 UTSW 5 73534637 missense probably damaging 0.97
R4788:Dcun1d4 UTSW 5 73534628 missense probably damaging 1.00
R4961:Dcun1d4 UTSW 5 73544120 nonsense probably null
R5245:Dcun1d4 UTSW 5 73557314 missense probably benign 0.11
R5284:Dcun1d4 UTSW 5 73522682 splice site probably null
R5457:Dcun1d4 UTSW 5 73531565 missense probably damaging 1.00
R5728:Dcun1d4 UTSW 5 73520148 missense possibly damaging 0.61
R6469:Dcun1d4 UTSW 5 73534614 missense probably damaging 0.99
R7165:Dcun1d4 UTSW 5 73491195 splice site probably null
R7439:Dcun1d4 UTSW 5 73491536 critical splice donor site probably null
R8706:Dcun1d4 UTSW 5 73557315 missense probably damaging 1.00
R8730:Dcun1d4 UTSW 5 73531489 splice site probably benign
R8768:Dcun1d4 UTSW 5 73520967 missense probably benign 0.03
R9326:Dcun1d4 UTSW 5 73522675 missense probably benign
X0063:Dcun1d4 UTSW 5 73555438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATGTCAAATTTTATGTCGTGCC -3'
(R):5'- TGGCTTTTCCATAGCACAGTATC -3'

Sequencing Primer
(F):5'- GTCAAATTTTATGTCGTGCCTTTTC -3'
(R):5'- GCTTTTCCATAGCACAGTATCATACC -3'
Posted On 2019-04-11