Incidental Mutation 'R6772:Rlbp1'
ID543636
Institutional Source Beutler Lab
Gene Symbol Rlbp1
Ensembl Gene ENSMUSG00000039194
Gene Nameretinaldehyde binding protein 1
Synonyms3110056M11Rik, CRALBP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6772 (G1)
Quality Score54.0073
Status Validated
Chromosome7
Chromosomal Location79374870-79387048 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 79384050 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053718] [ENSMUST00000179243] [ENSMUST00000205442] [ENSMUST00000205638] [ENSMUST00000206162] [ENSMUST00000206320] [ENSMUST00000206695]
Predicted Effect probably benign
Transcript: ENSMUST00000053718
SMART Domains Protein: ENSMUSP00000054545
Gene: ENSMUSG00000039194

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
low complexity region 54 68 N/A INTRINSIC
CRAL_TRIO_N 92 117 1.18e-7 SMART
SEC14 139 294 3.07e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179243
SMART Domains Protein: ENSMUSP00000137143
Gene: ENSMUSG00000039194

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
low complexity region 54 68 N/A INTRINSIC
CRAL_TRIO_N 92 117 1.18e-7 SMART
SEC14 139 294 3.07e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205442
Predicted Effect probably benign
Transcript: ENSMUST00000205638
Predicted Effect probably benign
Transcript: ENSMUST00000206162
Predicted Effect probably benign
Transcript: ENSMUST00000206320
Predicted Effect probably benign
Transcript: ENSMUST00000206695
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 36-kD water-soluble protein which carries 11-cis-retinaldehyde or 11-cis-retinal as physiologic ligands. It may be a functional component of the visual cycle. Mutations of this gene have been associated with severe rod-cone dystrophy, Bothnia dystrophy (nonsyndromic autosomal recessive retinitis pigmentosa) and retinitis punctata albescens. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display delayed dark adaptation as well as reduced retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,053 D1144V probably damaging Het
Ankrd13a A G 5: 114,801,743 H477R probably benign Het
Anxa3 A T 5: 96,811,113 I27F probably damaging Het
Aplf T C 6: 87,663,799 E76G possibly damaging Het
Bbs1 A G 19: 4,906,590 probably benign Het
Camk2a T C 18: 60,969,020 S332P probably benign Het
Casz1 T A 4: 148,943,206 F1013L probably damaging Het
Cd109 A T 9: 78,680,810 I707F possibly damaging Het
Cd4 G A 6: 124,872,458 T202I probably benign Het
Celsr1 A G 15: 86,030,782 S997P probably benign Het
Cfap77 T C 2: 29,054,939 T24A probably damaging Het
Dscaml1 G A 9: 45,710,311 R1019H probably damaging Het
Epb41l4b C A 4: 57,063,140 V517F probably benign Het
Exosc10 G A 4: 148,581,134 D818N probably damaging Het
Furin C T 7: 80,393,492 G324S probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifi206 T C 1: 173,481,207 M408V unknown Het
Kdm4a T C 4: 118,142,555 probably null Het
Neo1 T A 9: 58,902,976 Q1064L probably damaging Het
Nphp4 G A 4: 152,544,406 V750I probably benign Het
Pcdhac1 T C 18: 37,090,236 V34A probably benign Het
Pdk4 T C 6: 5,487,141 I302V probably benign Het
Prl6a1 A G 13: 27,319,048 D209G probably damaging Het
Pspn T C 17: 56,999,515 Q138R probably benign Het
Ptgs2 A G 1: 150,102,078 Y134C probably damaging Het
Rpia T C 6: 70,785,548 I108V probably benign Het
Tcaf1 A T 6: 42,675,276 H757Q probably damaging Het
Ttc8 A C 12: 98,943,589 S143R probably damaging Het
Uba6 A G 5: 86,147,073 probably benign Het
Ubr4 A T 4: 139,467,230 K4280* probably null Het
Vmn2r15 C A 5: 109,286,372 S822I probably damaging Het
Vps53 A T 11: 76,179,498 M1K probably null Het
Zfp362 A G 4: 128,790,260 M18T possibly damaging Het
Zfp429 A G 13: 67,390,198 C376R probably damaging Het
Zfyve9 T C 4: 108,639,269 N1395S probably damaging Het
Zmynd8 T A 2: 165,807,601 Q857H probably benign Het
Other mutations in Rlbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02435:Rlbp1 APN 7 79381666 missense probably damaging 1.00
IGL02606:Rlbp1 APN 7 79377289 missense possibly damaging 0.70
R1433:Rlbp1 UTSW 7 79383938 missense probably benign 0.05
R1434:Rlbp1 UTSW 7 79379913 splice site probably null
R1540:Rlbp1 UTSW 7 79380060 missense probably damaging 0.98
R1716:Rlbp1 UTSW 7 79375936 missense probably damaging 1.00
R4987:Rlbp1 UTSW 7 79380131 missense probably damaging 1.00
R5228:Rlbp1 UTSW 7 79377334 missense probably damaging 1.00
R6227:Rlbp1 UTSW 7 79380128 missense probably benign 0.38
R7086:Rlbp1 UTSW 7 79380065 missense possibly damaging 0.58
R7174:Rlbp1 UTSW 7 79377342 missense possibly damaging 0.88
R7352:Rlbp1 UTSW 7 79381680 missense probably damaging 1.00
R7552:Rlbp1 UTSW 7 79380113 missense probably damaging 1.00
R8809:Rlbp1 UTSW 7 79375956 missense probably damaging 1.00
R8826:Rlbp1 UTSW 7 79377366 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCCAAGATCTGTGCTCAG -3'
(R):5'- ACAAGTCCTTCAGAGCTAGGTAGG -3'

Sequencing Primer
(F):5'- GGCCCCAGAGAGATTGTTG -3'
(R):5'- GGAAGGAGGGCTCTAATTTTAGTCC -3'
Posted On2019-04-12