Incidental Mutation 'R6837:Stx16'
ID543639
Institutional Source Beutler Lab
Gene Symbol Stx16
Ensembl Gene ENSMUSG00000027522
Gene Namesyntaxin 16
SynonymsSYN16, 6330500A18Rik, 5430410K23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6837 (G1)
Quality Score43.0073
Status Validated
Chromosome2
Chromosomal Location174076308-174099771 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 174094002 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 242 (R242H)
Ref Sequence ENSEMBL: ENSMUSP00000085218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044638] [ENSMUST00000087908] [ENSMUST00000134876] [ENSMUST00000147038] [ENSMUST00000155000]
Predicted Effect probably benign
Transcript: ENSMUST00000044638
AA Change: R243H

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000039543
Gene: ENSMUSG00000027522
AA Change: R243H

DomainStartEndE-ValueType
Blast:SynN 76 190 2e-20 BLAST
t_SNARE 227 294 9.13e-23 SMART
transmembrane domain 305 324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087908
AA Change: R242H

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000085218
Gene: ENSMUSG00000027522
AA Change: R242H

DomainStartEndE-ValueType
Pfam:Syntaxin 74 174 2.1e-15 PFAM
t_SNARE 226 293 9.13e-23 SMART
transmembrane domain 304 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134876
Predicted Effect probably benign
Transcript: ENSMUST00000147038
SMART Domains Protein: ENSMUSP00000120279
Gene: ENSMUSG00000027522

DomainStartEndE-ValueType
Pfam:Syntaxin 21 121 3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155000
SMART Domains Protein: ENSMUSP00000119952
Gene: ENSMUSG00000027522

DomainStartEndE-ValueType
Pfam:Syntaxin 21 89 4.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156054
SMART Domains Protein: ENSMUSP00000116618
Gene: ENSMUSG00000027522

DomainStartEndE-ValueType
Blast:SynN 73 187 5e-21 BLAST
Pfam:SNARE 217 258 6.6e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for V-SNARES (vesicle-SNAP receptors) permitting specific synaptic vesicle docking and fusion. A microdeletion in the region of chromosome 20 where this gene is located has been associated with pseudohypoparathyroidism type Ib. Multiple transcript variants have been found for this gene. Read-through transcription also exists between this gene and the neighboring downstream aminopeptidase-like 1 (NPEPL1) gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and do not exhibit methylation abnormalities or develop a pseudohypoparathyroidism resistance phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 G A 12: 53,141,262 E1820K probably damaging Het
Anxa8 A T 14: 34,092,554 I116F probably damaging Het
Arid4a A G 12: 71,075,515 D890G probably benign Het
Aup1 C T 6: 83,057,298 T396I possibly damaging Het
C2cd3 G C 7: 100,448,746 E594Q probably damaging Het
Colgalt2 C T 1: 152,506,828 P477L probably damaging Het
D11Wsu47e A G 11: 113,688,613 H278R possibly damaging Het
Dennd3 G A 15: 73,557,693 D20N probably damaging Het
Dpysl3 A G 18: 43,437,882 I109T probably benign Het
Fas A T 19: 34,307,164 T24S probably damaging Het
Fras1 A T 5: 96,726,973 I2332F probably damaging Het
Gm10267 T C 18: 44,158,308 H32R probably benign Het
Hcfc2 A T 10: 82,739,196 I230F probably damaging Het
Hdac9 T C 12: 34,287,464 T673A probably benign Het
Herc2 T G 7: 56,189,841 N3366K possibly damaging Het
Hhla1 T C 15: 65,948,485 N139D probably damaging Het
Hip1r A G 5: 123,998,865 E632G possibly damaging Het
Kcnc2 A G 10: 112,458,502 D98G probably damaging Het
Maip1 T A 1: 57,415,732 *292K probably null Het
Map2 T C 1: 66,414,572 F874L probably damaging Het
Myof A T 19: 37,922,956 probably null Het
Notch2 A G 3: 98,070,854 probably null Het
Npy5r T A 8: 66,681,740 M134L probably benign Het
Ntsr2 T A 12: 16,659,709 M225K probably benign Het
Nup153 G A 13: 46,694,051 T634I probably damaging Het
Olfr583 T A 7: 103,051,722 Y141* probably null Het
Pcsk5 T C 19: 17,439,084 S1667G probably benign Het
Pex13 A G 11: 23,649,527 I328T possibly damaging Het
Pkd2 T G 5: 104,477,043 L235W probably damaging Het
Prune2 A T 19: 17,178,928 D66V probably damaging Het
Rasal3 T C 17: 32,403,070 N105S probably benign Het
Sla A T 15: 66,787,090 I144N probably damaging Het
Slc5a4b A T 10: 76,062,386 I498N possibly damaging Het
Snx14 C T 9: 88,380,223 E872K probably benign Het
Tg T C 15: 66,696,135 F1296S probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmf1 G A 6: 97,176,581 T177M possibly damaging Het
Tuba4a T C 1: 75,217,394 Q14R probably damaging Het
Vmn2r114 T C 17: 23,310,202 M309V probably benign Het
Vps13c C T 9: 67,910,222 P1059S probably benign Het
Yars T A 4: 129,209,751 S298T possibly damaging Het
Other mutations in Stx16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Stx16 APN 2 174092409 missense probably damaging 1.00
IGL01626:Stx16 APN 2 174094020 missense probably damaging 1.00
IGL03052:Stx16 UTSW 2 174092438 missense probably benign 0.01
R0257:Stx16 UTSW 2 174096961 missense probably benign 0.39
R4929:Stx16 UTSW 2 174096928 missense possibly damaging 0.94
R5728:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5729:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5746:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5772:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5774:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5776:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R6147:Stx16 UTSW 2 174090687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCCTGTCTGGGAAATAAGTTAC -3'
(R):5'- AGGGAATGACAGTAGCCCAC -3'

Sequencing Primer
(F):5'- GGGAAATAAGTTACCTGTTGCC -3'
(R):5'- TGACAGTAGCCCACATCACCTG -3'
Posted On2019-04-17