Incidental Mutation 'R6829:Pgc'
ID 543641
Institutional Source Beutler Lab
Gene Symbol Pgc
Ensembl Gene ENSMUSG00000023987
Gene Name progastricsin (pepsinogen C)
Synonyms Upg1, 2210410L06Rik, Upg-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6829 (G1)
Quality Score 75.0075
Status Validated
Chromosome 17
Chromosomal Location 47726842-47734482 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 47732781 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024782] [ENSMUST00000086932] [ENSMUST00000126258] [ENSMUST00000144955]
AlphaFold Q9D7R7
Predicted Effect probably null
Transcript: ENSMUST00000024782
SMART Domains Protein: ENSMUSP00000024782
Gene: ENSMUSG00000023987

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 18 46 2.1e-17 PFAM
Pfam:Asp 75 391 6.3e-118 PFAM
Pfam:TAXi_N 76 232 7.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086932
SMART Domains Protein: ENSMUSP00000084151
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126258
Predicted Effect probably benign
Transcript: ENSMUST00000144955
SMART Domains Protein: ENSMUSP00000123459
Gene: ENSMUSG00000023987

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 18 46 1.5e-18 PFAM
Pfam:Asp 63 143 1.4e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an aspartic proteinase that belongs to the peptidase family A1. The encoded protein is a digestive enzyme that is produced in the stomach and constitutes a major component of the gastric mucosa. This protein is also secreted into the serum. This protein is synthesized as an inactive zymogen that includes a highly basic prosegment. This enzyme is converted into its active mature form at low pH by sequential cleavage of the prosegment that is carried out by the enzyme itself. Polymorphisms in this gene are associated with susceptibility to gastric cancers. Serum levels of this enzyme are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A G 14: 49,226,568 *295Q probably null Het
Adam2 A T 14: 66,027,997 probably null Het
Adamts5 A T 16: 85,870,071 M511K possibly damaging Het
Adcy9 A G 16: 4,307,154 probably null Het
Cast T C 13: 74,728,344 E113G possibly damaging Het
Dcaf1 T A 9: 106,838,604 S307T probably damaging Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Elac2 A G 11: 64,989,364 E111G probably benign Het
Fam208a A G 14: 27,442,481 D248G possibly damaging Het
Fbxw4 A G 19: 45,636,374 F57S possibly damaging Het
Gm17655 T G 5: 110,046,926 H330P probably damaging Het
Gm2a T C 11: 55,103,750 probably null Het
Gon4l T A 3: 88,880,106 D600E possibly damaging Het
Gsg1l2 T C 11: 67,774,858 I84T possibly damaging Het
Igsf9 A G 1: 172,495,674 R652G probably benign Het
Il17rd C T 14: 27,087,422 R112* probably null Het
Jph1 C A 1: 17,004,423 R457L probably damaging Het
Khdrbs3 T C 15: 69,092,961 V249A possibly damaging Het
Mocs2 A G 13: 114,819,444 S43G probably benign Het
Myom2 T A 8: 15,122,643 L1190* probably null Het
Olfr1080 A T 2: 86,553,269 L285* probably null Het
Olfr1318 G C 2: 112,155,794 probably benign Het
Olfr198 A G 16: 59,201,535 V297A probably damaging Het
Olfr263 T A 13: 21,132,853 I26N possibly damaging Het
Plch1 T G 3: 63,697,518 D1655A probably damaging Het
Pnliprp2 G A 19: 58,759,873 G29R probably benign Het
Polg A G 7: 79,460,109 V382A probably benign Het
Rb1cc1 T C 1: 6,249,264 I969T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Sema7a A G 9: 57,960,898 E538G probably benign Het
Slc2a2 C T 3: 28,727,441 Q513* probably null Het
Slc4a8 A G 15: 100,800,538 Y636C probably damaging Het
Trpm5 A G 7: 143,069,429 probably benign Het
Vmn1r14 T C 6: 57,233,551 L38P probably benign Het
Washc4 T C 10: 83,560,516 S397P probably damaging Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zan A G 5: 137,416,278 probably benign Het
Zfhx3 C T 8: 108,950,283 T2655M probably damaging Het
Other mutations in Pgc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Pgc APN 17 47730666 missense probably benign 0.09
IGL01410:Pgc APN 17 47734240 missense probably damaging 0.98
IGL01647:Pgc APN 17 47732404 missense probably damaging 1.00
IGL02141:Pgc APN 17 47726931 missense probably damaging 1.00
IGL02719:Pgc APN 17 47728867 missense probably damaging 0.98
PIT4469001:Pgc UTSW 17 47728755 nonsense probably null
R0736:Pgc UTSW 17 47728780 missense probably damaging 1.00
R1118:Pgc UTSW 17 47728903 critical splice donor site probably null
R1669:Pgc UTSW 17 47733790 missense probably damaging 1.00
R2162:Pgc UTSW 17 47729311 missense probably null 0.96
R3831:Pgc UTSW 17 47729311 missense probably null 0.96
R3833:Pgc UTSW 17 47729311 missense probably null 0.96
R4454:Pgc UTSW 17 47732410 missense probably benign 0.00
R4908:Pgc UTSW 17 47728894 missense probably damaging 0.96
R5544:Pgc UTSW 17 47732504 missense probably benign 0.00
R7042:Pgc UTSW 17 47733820 missense probably benign 0.00
R7508:Pgc UTSW 17 47734186 missense probably benign 0.00
R8022:Pgc UTSW 17 47728776 missense probably benign 0.00
R9028:Pgc UTSW 17 47733058 missense possibly damaging 0.51
R9074:Pgc UTSW 17 47732426 missense probably damaging 0.98
Z1176:Pgc UTSW 17 47728868 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCACCTATGCAGCAGTCTG -3'
(R):5'- TCTACAATGCCTTGGCAGC -3'

Sequencing Primer
(F):5'- TATGCAGCAGTCTGGCAGC -3'
(R):5'- CCTGGTTGCCAATAAGGAAGCTG -3'
Posted On 2019-04-17