Incidental Mutation 'R6794:Herpud1'
ID543646
Institutional Source Beutler Lab
Gene Symbol Herpud1
Ensembl Gene ENSMUSG00000031770
Gene Namehomocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
SynonymsHerp, Mifl
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R6794 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location94386438-94395377 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 94394770 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034220] [ENSMUST00000161085] [ENSMUST00000161576] [ENSMUST00000211982]
Predicted Effect probably benign
Transcript: ENSMUST00000034220
SMART Domains Protein: ENSMUSP00000034220
Gene: ENSMUSG00000031770

DomainStartEndE-ValueType
UBQ 10 86 1.99e-13 SMART
low complexity region 216 242 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159450
Predicted Effect probably benign
Transcript: ENSMUST00000161085
Predicted Effect probably benign
Transcript: ENSMUST00000161576
SMART Domains Protein: ENSMUSP00000124201
Gene: ENSMUSG00000031770

DomainStartEndE-ValueType
UBQ 10 87 7.55e-14 SMART
low complexity region 217 243 N/A INTRINSIC
low complexity region 274 291 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000211982
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The accumulation of unfolded proteins in the endoplasmic reticulum (ER) triggers the ER stress response. This response includes the inhibition of translation to prevent further accumulation of unfolded proteins, the increased expression of proteins involved in polypeptide folding, known as the unfolded protein response (UPR), and the destruction of misfolded proteins by the ER-associated protein degradation (ERAD) system. This gene may play a role in both UPR and ERAD. Its expression is induced by UPR and it has an ER stress response element in its promoter region while the encoded protein has an N-terminal ubiquitin-like domain which may interact with the ERAD system. This protein has been shown to interact with presenilin proteins and to increase the level of amyloid-beta protein following its overexpression. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. The full-length nature of all transcript variants has not been determined. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired glucose tolerance and decreased cerebral infarction size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,637,855 probably null Het
Agxt T C 1: 93,135,382 V30A possibly damaging Het
Atf7 T C 15: 102,557,465 K87E probably benign Het
Btg4 A C 9: 51,119,351 K250N possibly damaging Het
Cyc1 A G 15: 76,344,650 Y132C probably damaging Het
Dcaf5 A T 12: 80,398,893 D137E possibly damaging Het
Ddr2 C A 1: 169,982,098 W770L probably damaging Het
Disc1 T C 8: 125,087,775 V126A probably benign Het
Dock8 A G 19: 25,122,441 N643D probably benign Het
Gabrg1 C T 5: 70,815,971 R75H probably damaging Het
Gm14418 A T 2: 177,387,838 H121Q probably damaging Het
H2-Ob T A 17: 34,241,188 L20Q possibly damaging Het
Ica1 T C 6: 8,653,659 D326G probably benign Het
Jph3 T C 8: 121,785,385 L704P probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lnpep T G 17: 17,531,159 N948T probably damaging Het
Mdn1 T A 4: 32,741,893 V3888D probably damaging Het
Muc5ac T C 7: 141,809,552 probably benign Het
Nfkb2 T C 19: 46,307,720 probably null Het
Pik3r2 T C 8: 70,770,717 H380R probably benign Het
Prim1 T C 10: 128,018,149 S124P probably damaging Het
Prokr1 T C 6: 87,588,693 T57A possibly damaging Het
Ptpn4 T C 1: 119,743,390 T213A probably damaging Het
Sapcd2 A G 2: 25,376,367 S389G probably damaging Het
Scn5a T C 9: 119,535,889 Q421R probably damaging Het
Serac1 A G 17: 6,051,710 Y430H probably damaging Het
Shf A G 2: 122,353,840 L234P probably damaging Het
Slc22a29 G T 19: 8,161,523 S525Y probably benign Het
Thbs1 A G 2: 118,120,038 probably null Het
Tln2 T C 9: 67,286,558 D666G probably benign Het
Ubqlnl C T 7: 104,148,785 E502K probably benign Het
Uhrf1bp1l T C 10: 89,805,762 S932P probably benign Het
Vmn2r118 T A 17: 55,592,348 H852L possibly damaging Het
Vmn2r72 A G 7: 85,737,996 F787L probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Ylpm1 A G 12: 84,996,881 H131R unknown Het
Other mutations in Herpud1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02506:Herpud1 APN 8 94394642 nonsense probably null
R1667:Herpud1 UTSW 8 94389366 missense probably damaging 1.00
R2015:Herpud1 UTSW 8 94392206 missense probably benign 0.44
R2255:Herpud1 UTSW 8 94394613 missense probably benign 0.06
R3707:Herpud1 UTSW 8 94392239 missense probably damaging 1.00
R4940:Herpud1 UTSW 8 94390842 missense probably benign 0.18
R4961:Herpud1 UTSW 8 94390826 missense probably benign 0.00
R4981:Herpud1 UTSW 8 94391794 missense probably damaging 1.00
R5214:Herpud1 UTSW 8 94390851 splice site probably null
R5499:Herpud1 UTSW 8 94389413 missense probably damaging 1.00
R5835:Herpud1 UTSW 8 94392239 missense probably damaging 1.00
R5985:Herpud1 UTSW 8 94390794 missense probably damaging 1.00
R6702:Herpud1 UTSW 8 94392526 critical splice donor site probably null
R7060:Herpud1 UTSW 8 94390763 missense probably benign 0.04
R7100:Herpud1 UTSW 8 94390847 missense probably damaging 0.98
R7328:Herpud1 UTSW 8 94386620 missense possibly damaging 0.76
R7384:Herpud1 UTSW 8 94389377 missense probably damaging 0.98
R7898:Herpud1 UTSW 8 94392200 missense probably benign 0.05
R7981:Herpud1 UTSW 8 94392200 missense probably benign 0.05
R8025:Herpud1 UTSW 8 94392521 missense probably damaging 1.00
R8036:Herpud1 UTSW 8 94392386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGTTCCTCTAGACCCTAATC -3'
(R):5'- GGGCCCTGTTCAGTTTGTAC -3'

Sequencing Primer
(F):5'- TGCCTATAGGGAGGTATGGACCC -3'
(R):5'- AGTTTGTACCACGGCTTCATG -3'
Posted On2019-04-22