Incidental Mutation 'R6794:Herpud1'
ID 543646
Institutional Source Beutler Lab
Gene Symbol Herpud1
Ensembl Gene ENSMUSG00000031770
Gene Name homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
Synonyms Mifl, Herp
MMRRC Submission 044907-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.352) question?
Stock # R6794 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 95113066-95122005 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 95121398 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034220] [ENSMUST00000161085] [ENSMUST00000161576] [ENSMUST00000211982]
AlphaFold Q9JJK5
Predicted Effect probably benign
Transcript: ENSMUST00000034220
SMART Domains Protein: ENSMUSP00000034220
Gene: ENSMUSG00000031770

DomainStartEndE-ValueType
UBQ 10 86 1.99e-13 SMART
low complexity region 216 242 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159450
Predicted Effect probably benign
Transcript: ENSMUST00000161085
Predicted Effect probably benign
Transcript: ENSMUST00000161576
SMART Domains Protein: ENSMUSP00000124201
Gene: ENSMUSG00000031770

DomainStartEndE-ValueType
UBQ 10 87 7.55e-14 SMART
low complexity region 217 243 N/A INTRINSIC
low complexity region 274 291 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000211982
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The accumulation of unfolded proteins in the endoplasmic reticulum (ER) triggers the ER stress response. This response includes the inhibition of translation to prevent further accumulation of unfolded proteins, the increased expression of proteins involved in polypeptide folding, known as the unfolded protein response (UPR), and the destruction of misfolded proteins by the ER-associated protein degradation (ERAD) system. This gene may play a role in both UPR and ERAD. Its expression is induced by UPR and it has an ER stress response element in its promoter region while the encoded protein has an N-terminal ubiquitin-like domain which may interact with the ERAD system. This protein has been shown to interact with presenilin proteins and to increase the level of amyloid-beta protein following its overexpression. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. The full-length nature of all transcript variants has not been determined. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired glucose tolerance and decreased cerebral infarction size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agxt T C 1: 93,063,104 (GRCm39) V30A possibly damaging Het
Atf7 T C 15: 102,465,900 (GRCm39) K87E probably benign Het
Bltp3b T C 10: 89,641,624 (GRCm39) S932P probably benign Het
Btg4 A C 9: 51,030,651 (GRCm39) K250N possibly damaging Het
Cracdl A G 1: 37,676,936 (GRCm39) probably null Het
Cyc1 A G 15: 76,228,850 (GRCm39) Y132C probably damaging Het
Dcaf5 A T 12: 80,445,667 (GRCm39) D137E possibly damaging Het
Ddr2 C A 1: 169,809,667 (GRCm39) W770L probably damaging Het
Disc1 T C 8: 125,814,514 (GRCm39) V126A probably benign Het
Dock8 A G 19: 25,099,805 (GRCm39) N643D probably benign Het
Gabrg1 C T 5: 70,973,314 (GRCm39) R75H probably damaging Het
Gm14418 A T 2: 177,079,631 (GRCm39) H121Q probably damaging Het
H2-Ob T A 17: 34,460,162 (GRCm39) L20Q possibly damaging Het
Ica1 T C 6: 8,653,659 (GRCm39) D326G probably benign Het
Jph3 T C 8: 122,512,124 (GRCm39) L704P probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,704,474 (GRCm39) probably benign Het
Lnpep T G 17: 17,751,421 (GRCm39) N948T probably damaging Het
Mdn1 T A 4: 32,741,893 (GRCm39) V3888D probably damaging Het
Muc5ac T C 7: 141,363,289 (GRCm39) probably benign Het
Nfkb2 T C 19: 46,296,159 (GRCm39) probably null Het
Pik3r2 T C 8: 71,223,361 (GRCm39) H380R probably benign Het
Prim1 T C 10: 127,854,018 (GRCm39) S124P probably damaging Het
Prokr1 T C 6: 87,565,675 (GRCm39) T57A possibly damaging Het
Ptpn4 T C 1: 119,671,120 (GRCm39) T213A probably damaging Het
Sapcd2 A G 2: 25,266,379 (GRCm39) S389G probably damaging Het
Scn5a T C 9: 119,364,955 (GRCm39) Q421R probably damaging Het
Serac1 A G 17: 6,101,985 (GRCm39) Y430H probably damaging Het
Shf A G 2: 122,184,321 (GRCm39) L234P probably damaging Het
Slc22a29 G T 19: 8,138,887 (GRCm39) S525Y probably benign Het
Thbs1 A G 2: 117,950,519 (GRCm39) probably null Het
Tln2 T C 9: 67,193,840 (GRCm39) D666G probably benign Het
Ubqlnl C T 7: 103,797,992 (GRCm39) E502K probably benign Het
Vmn2r118 T A 17: 55,899,348 (GRCm39) H852L possibly damaging Het
Vmn2r72 A G 7: 85,387,204 (GRCm39) F787L probably damaging Het
Xpc G A 6: 91,483,839 (GRCm39) A169V probably benign Het
Ylpm1 A G 12: 85,043,655 (GRCm39) H131R unknown Het
Other mutations in Herpud1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02506:Herpud1 APN 8 95,121,270 (GRCm39) nonsense probably null
R1667:Herpud1 UTSW 8 95,115,994 (GRCm39) missense probably damaging 1.00
R2015:Herpud1 UTSW 8 95,118,834 (GRCm39) missense probably benign 0.44
R2255:Herpud1 UTSW 8 95,121,241 (GRCm39) missense probably benign 0.06
R3707:Herpud1 UTSW 8 95,118,867 (GRCm39) missense probably damaging 1.00
R4940:Herpud1 UTSW 8 95,117,470 (GRCm39) missense probably benign 0.18
R4961:Herpud1 UTSW 8 95,117,454 (GRCm39) missense probably benign 0.00
R4981:Herpud1 UTSW 8 95,118,422 (GRCm39) missense probably damaging 1.00
R5214:Herpud1 UTSW 8 95,117,479 (GRCm39) splice site probably null
R5499:Herpud1 UTSW 8 95,116,041 (GRCm39) missense probably damaging 1.00
R5835:Herpud1 UTSW 8 95,118,867 (GRCm39) missense probably damaging 1.00
R5985:Herpud1 UTSW 8 95,117,422 (GRCm39) missense probably damaging 1.00
R6702:Herpud1 UTSW 8 95,119,154 (GRCm39) critical splice donor site probably null
R7060:Herpud1 UTSW 8 95,117,391 (GRCm39) missense probably benign 0.04
R7100:Herpud1 UTSW 8 95,117,475 (GRCm39) missense probably damaging 0.98
R7328:Herpud1 UTSW 8 95,113,248 (GRCm39) missense possibly damaging 0.76
R7384:Herpud1 UTSW 8 95,116,005 (GRCm39) missense probably damaging 0.98
R7898:Herpud1 UTSW 8 95,118,828 (GRCm39) missense probably benign 0.05
R8025:Herpud1 UTSW 8 95,119,149 (GRCm39) missense probably damaging 1.00
R8036:Herpud1 UTSW 8 95,119,014 (GRCm39) missense probably damaging 1.00
R8872:Herpud1 UTSW 8 95,113,213 (GRCm39) unclassified probably benign
R8965:Herpud1 UTSW 8 95,118,469 (GRCm39) missense probably damaging 1.00
R9022:Herpud1 UTSW 8 95,116,197 (GRCm39) missense possibly damaging 0.68
R9050:Herpud1 UTSW 8 95,117,454 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTGTTCCTCTAGACCCTAATC -3'
(R):5'- GGGCCCTGTTCAGTTTGTAC -3'

Sequencing Primer
(F):5'- TGCCTATAGGGAGGTATGGACCC -3'
(R):5'- AGTTTGTACCACGGCTTCATG -3'
Posted On 2019-04-22