Incidental Mutation 'R6890:Rad17'
ID543653
Institutional Source Beutler Lab
Gene Symbol Rad17
Ensembl Gene ENSMUSG00000021635
Gene NameRAD17 checkpoint clamp loader component
SynonymsMmRad24, 9430035O09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location100617164-100651051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100637084 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 201 (I201V)
Ref Sequence ENSEMBL: ENSMUSP00000152977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022136] [ENSMUST00000177848] [ENSMUST00000226050]
Predicted Effect silent
Transcript: ENSMUST00000022136
SMART Domains Protein: ENSMUSP00000022136
Gene: ENSMUSG00000021635

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000177848
SMART Domains Protein: ENSMUSP00000136292
Gene: ENSMUSG00000021635

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226050
AA Change: I201V

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad17, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This protein shares strong similarity with DNA replication factor C (RFC), and can form a complex with RFCs. This protein binds to chromatin prior to DNA damage and is phosphorylated by the checkpoint kinase ATR following damage. This protein recruits the RAD1-RAD9-HUS1 checkpoint protein complex onto chromatin after DNA damage, which may be required for its phosphorylation. The phosphorylation of this protein is required for the DNA-damage-induced cell cycle G2 arrest, and is thought to be a critical early event during checkpoint signaling in DNA-damaged cells. Multiple alternatively spliced transcript variants of this gene, which encode four distinct protein isoforms, have been reported. Two pseudogenes, located on chromosomes 7 and 13, have been identified. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with incomplete somite formation, abnormal bracnchial arch, liver, and heart morphology, abnormal neural tube development, and multiple hemorrhages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Rad17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Rad17 APN 13 100629525 missense probably benign 0.03
IGL00422:Rad17 APN 13 100629523 missense probably damaging 0.98
IGL00478:Rad17 APN 13 100633274 missense probably damaging 1.00
IGL01328:Rad17 APN 13 100617803 missense probably benign
IGL01720:Rad17 APN 13 100622858 missense possibly damaging 0.51
IGL01874:Rad17 APN 13 100617684 utr 3 prime probably benign
IGL02305:Rad17 APN 13 100633862 critical splice donor site probably null
IGL02541:Rad17 APN 13 100633443 splice site probably benign
R0678:Rad17 UTSW 13 100645184 missense possibly damaging 0.73
R1079:Rad17 UTSW 13 100633899 missense probably benign 0.01
R1422:Rad17 UTSW 13 100645082 missense probably benign 0.18
R1730:Rad17 UTSW 13 100622806 missense probably damaging 0.97
R3946:Rad17 UTSW 13 100622863 missense possibly damaging 0.70
R4577:Rad17 UTSW 13 100633278 missense probably damaging 1.00
R4735:Rad17 UTSW 13 100619129 missense probably damaging 0.98
R5023:Rad17 UTSW 13 100645063 missense possibly damaging 0.88
R5098:Rad17 UTSW 13 100617646 makesense probably null
R5222:Rad17 UTSW 13 100633891 missense possibly damaging 0.53
R5511:Rad17 UTSW 13 100627649 missense possibly damaging 0.82
R5536:Rad17 UTSW 13 100631104 missense probably damaging 1.00
R5887:Rad17 UTSW 13 100633861 critical splice donor site probably null
R6041:Rad17 UTSW 13 100617766 missense probably benign 0.01
R6173:Rad17 UTSW 13 100622881 missense probably benign
R6342:Rad17 UTSW 13 100619136 missense probably damaging 1.00
R6465:Rad17 UTSW 13 100637080 missense probably benign 0.34
R6730:Rad17 UTSW 13 100649745 start gained probably benign
R6947:Rad17 UTSW 13 100622875 missense probably damaging 1.00
R7035:Rad17 UTSW 13 100627625 missense possibly damaging 0.78
R7113:Rad17 UTSW 13 100629517 missense probably benign 0.03
R7408:Rad17 UTSW 13 100629511 nonsense probably null
R7553:Rad17 UTSW 13 100633286 missense probably damaging 1.00
R7573:Rad17 UTSW 13 100629466 missense probably damaging 0.99
R8313:Rad17 UTSW 13 100624566 missense probably benign 0.02
R8346:Rad17 UTSW 13 100645173 missense possibly damaging 0.77
R8739:Rad17 UTSW 13 100629490 missense probably benign
R8874:Rad17 UTSW 13 100617819 missense probably benign 0.00
RF022:Rad17 UTSW 13 100637085 missense probably damaging 1.00
Z1176:Rad17 UTSW 13 100627632 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCAGCGCCTTCCAAGTAAAC -3'
(R):5'- CCCGTGCCTTTTGTTTAGCTAAAG -3'

Sequencing Primer
(F):5'- GCGCCTTCCAAGTAAACTTACC -3'
(R):5'- GAAAACAATCCTCTCAGATCT -3'
Posted On2019-04-24