Incidental Mutation 'R6910:Chil5'
ID 543656
Institutional Source Beutler Lab
Gene Symbol Chil5
Ensembl Gene ENSMUSG00000043873
Gene Name chitinase-like 5
Synonyms Chi3l7, Bclp1, Bclp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R6910 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 106016919-106032814 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106019661 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 82 (W82R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066537] [ENSMUST00000200146]
AlphaFold A0A0G2JDS2
Predicted Effect probably damaging
Transcript: ENSMUST00000054973
AA Change: W82R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052345
Gene: ENSMUSG00000043873
AA Change: W82R

DomainStartEndE-ValueType
Pfam:Glyco_hydro_18 1 156 5.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066537
SMART Domains Protein: ENSMUSP00000065043
Gene: ENSMUSG00000043873

DomainStartEndE-ValueType
Glyco_18 1 174 2.61e-16 SMART
Predicted Effect silent
Transcript: ENSMUST00000200146
SMART Domains Protein: ENSMUSP00000142477
Gene: ENSMUSG00000043873

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 2.1e-133 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,620,447 V151A probably damaging Het
Cfap54 A G 10: 92,836,512 S2899P probably benign Het
Dennd3 A G 15: 73,555,116 T781A probably benign Het
Epha2 A G 4: 141,321,513 D597G probably damaging Het
Gcn1l1 A G 5: 115,606,538 T1598A probably benign Het
Glp2r A G 11: 67,730,671 F162S probably benign Het
Gm10130 A T 2: 150,324,067 Q56L probably benign Het
Gm17655 T A 5: 110,047,173 R248* probably null Het
Gm9268 T C 7: 43,024,051 F178L probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Hapln2 A G 3: 88,023,828 Y127H probably damaging Het
Hdac4 G T 1: 91,982,153 T463K probably damaging Het
Ift80 A C 3: 68,927,735 S458A probably benign Het
Lama1 A G 17: 67,791,464 D1846G possibly damaging Het
Map3k8 A G 18: 4,340,801 I171T probably benign Het
Micu1 A G 10: 59,740,667 E115G probably damaging Het
Mrpl39 A G 16: 84,735,192 V9A unknown Het
Ncoa7 T G 10: 30,694,121 I281L possibly damaging Het
Nms A G 1: 38,941,895 E54G probably benign Het
Nrip1 G A 16: 76,294,417 A84V probably damaging Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr743 G A 14: 50,533,873 V154M probably benign Het
Pcdhga10 T A 18: 37,748,232 S349T probably damaging Het
R3hcc1 G A 14: 69,697,575 P454L probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr3 T C 2: 112,958,175 D170G probably damaging Het
Scp2 C A 4: 108,105,086 G81C probably damaging Het
Sez6 A G 11: 77,953,869 T173A possibly damaging Het
Syne1 T C 10: 5,048,887 H8142R probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tnfrsf11a A G 1: 105,844,546 T520A probably damaging Het
Tpm1 A G 9: 67,031,974 S170P probably damaging Het
Try5 T C 6: 41,311,799 D54G possibly damaging Het
Zan T C 5: 137,419,080 E3041G unknown Het
Zfp616 A T 11: 74,085,002 H699L probably damaging Het
Other mutations in Chil5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01812:Chil5 APN 3 106017152 missense possibly damaging 0.73
IGL02959:Chil5 APN 3 106019590 missense probably damaging 1.00
R0255:Chil5 UTSW 3 106019267 missense probably damaging 1.00
R0409:Chil5 UTSW 3 106034966 unclassified probably benign
R0635:Chil5 UTSW 3 106017203 missense possibly damaging 0.50
R1403:Chil5 UTSW 3 106018093 missense probably benign 0.06
R1403:Chil5 UTSW 3 106018093 missense probably benign 0.06
R3500:Chil5 UTSW 3 106018220 missense probably damaging 1.00
R4426:Chil5 UTSW 3 106019627 missense probably damaging 0.96
R4680:Chil5 UTSW 3 106034875 unclassified probably benign
R4998:Chil5 UTSW 3 106019932 missense probably damaging 0.99
R5045:Chil5 UTSW 3 106024140 missense possibly damaging 0.61
R5113:Chil5 UTSW 3 106017978 missense possibly damaging 0.91
R5274:Chil5 UTSW 3 106028853 missense probably damaging 1.00
R5627:Chil5 UTSW 3 106019635 missense probably damaging 1.00
R7476:Chil5 UTSW 3 106020007 missense possibly damaging 0.69
R8772:Chil5 UTSW 3 106018220 missense probably damaging 1.00
Z1177:Chil5 UTSW 3 106028818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCTTAGTTAGATCTGTGC -3'
(R):5'- GAACTCCTGTAAGAGCATAAGCAG -3'

Sequencing Primer
(F):5'- ATCTGTGCTGGGTTATATTACTTGCC -3'
(R):5'- AAGCAGAGGATCTTAATTCTTGGG -3'
Posted On 2019-04-30