Incidental Mutation 'R6781:AI182371'
ID543664
Institutional Source Beutler Lab
Gene Symbol AI182371
Ensembl Gene ENSMUSG00000035875
Gene Nameexpressed sequence AI182371
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_178885; MGI: 2138853

Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6781 (G1)
Quality Score69.0074
Status Validated
Chromosome2
Chromosomal Location35081861-35101543 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 35084705 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045776] [ENSMUST00000134940] [ENSMUST00000226375] [ENSMUST00000226631] [ENSMUST00000226972]
Predicted Effect unknown
Transcript: ENSMUST00000045776
AA Change: H345N
SMART Domains Protein: ENSMUSP00000037754
Gene: ENSMUSG00000035875
AA Change: H345N

DomainStartEndE-ValueType
Pfam:A2M_N 133 227 4.7e-19 PFAM
ANATO 284 318 1.97e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154817
Predicted Effect probably benign
Transcript: ENSMUST00000226375
Predicted Effect probably benign
Transcript: ENSMUST00000226631
Predicted Effect probably benign
Transcript: ENSMUST00000226972
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (45/46)
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,374,406 I259N possibly damaging Het
Acot12 G T 13: 91,784,412 probably null Het
Amigo3 T C 9: 108,053,963 L195P probably damaging Het
Aox4 A T 1: 58,245,109 D556V probably benign Het
Arhgef40 A C 14: 51,997,897 probably benign Het
Asb15 T C 6: 24,558,675 V63A probably benign Het
Bicd1 T C 6: 149,513,166 I459T possibly damaging Het
Bub1 C A 2: 127,807,857 G694W probably damaging Het
C4b A T 17: 34,742,954 I106N probably damaging Het
Clca4b T C 3: 144,922,801 I382V probably benign Het
Cntnap5a A C 1: 116,292,397 S646R probably benign Het
Cntnap5c C T 17: 58,138,653 Q563* probably null Het
Cpn1 A G 19: 43,980,904 F107L possibly damaging Het
Csrnp3 T A 2: 66,022,271 C336S probably benign Het
Defa3 T A 8: 21,288,261 M87K probably benign Het
Dmbt1 T C 7: 131,046,561 F274L probably benign Het
Dnah8 TTA TTATA 17: 30,765,724 probably null Het
Dnase2b T C 3: 146,582,371 H323R probably benign Het
Fam83e A T 7: 45,722,147 probably benign Het
Fbn1 T C 2: 125,317,038 N2269S probably damaging Het
Foxa1 A T 12: 57,543,257 M59K possibly damaging Het
Fpr3 T C 17: 17,970,716 V83A probably benign Het
Frmd6 A G 12: 70,899,643 D615G possibly damaging Het
Gfra3 T C 18: 34,711,322 K55R possibly damaging Het
Gm5414 A T 15: 101,625,661 S296T possibly damaging Het
Gtf3c1 T A 7: 125,659,197 K1234* probably null Het
Hltf T A 3: 20,098,166 Y609N probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift74 A G 4: 94,627,302 D152G probably damaging Het
Kcnk6 T C 7: 29,225,055 Y308C probably damaging Het
Klhl29 A G 12: 5,091,347 S546P probably damaging Het
Map7d1 AGGGCAGCC AGGGCAGCCGGGCAGCC 4: 126,240,751 probably null Het
Meis2 T A 2: 116,049,155 H228L probably benign Het
Mfsd10 A T 5: 34,634,509 M344K possibly damaging Het
Mrps33 T C 6: 39,805,823 probably benign Het
Olfr1198 A T 2: 88,746,830 N19K probably benign Het
Olfr437 A G 6: 43,167,388 E110G probably damaging Het
Pik3cb T C 9: 99,040,992 T996A possibly damaging Het
Plekha7 A G 7: 116,157,855 probably null Het
Ppp1cb A G 5: 32,480,762 Y86C probably damaging Het
Sass6 T G 3: 116,595,124 probably benign Het
Slc6a15 A T 10: 103,395,067 I218F probably damaging Het
St5 T C 7: 109,525,304 D1110G possibly damaging Het
Tcf23 C T 5: 30,968,960 P61L probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zc3h6 T C 2: 129,015,421 F620S probably damaging Het
Other mutations in AI182371
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02338:AI182371 APN 2 35085716 missense probably benign 0.02
IGL02344:AI182371 APN 2 35089186 missense probably benign 0.01
IGL02817:AI182371 APN 2 35100649 missense probably damaging 0.99
IGL02961:AI182371 APN 2 35086112 missense possibly damaging 0.53
3-1:AI182371 UTSW 2 35100607 missense probably damaging 0.99
R0041:AI182371 UTSW 2 35085721 missense possibly damaging 0.79
R0084:AI182371 UTSW 2 35085702 critical splice donor site probably null
R0472:AI182371 UTSW 2 35085206 missense probably benign 0.35
R1539:AI182371 UTSW 2 35088803 missense probably damaging 0.98
R1634:AI182371 UTSW 2 35086485 missense probably damaging 1.00
R1635:AI182371 UTSW 2 35088737 splice site probably null
R1898:AI182371 UTSW 2 35100649 missense probably damaging 0.99
R2065:AI182371 UTSW 2 35086429 critical splice donor site probably null
R2155:AI182371 UTSW 2 35085354 missense probably benign 0.00
R3694:AI182371 UTSW 2 35085752 missense probably benign 0.00
R3900:AI182371 UTSW 2 35085216 missense probably benign 0.01
R4766:AI182371 UTSW 2 35095817 missense possibly damaging 0.78
R5071:AI182371 UTSW 2 35085215 missense probably benign 0.17
R5500:AI182371 UTSW 2 35100638 missense probably damaging 0.99
R5907:AI182371 UTSW 2 35086122 missense possibly damaging 0.66
R6146:AI182371 UTSW 2 35097971 missense probably damaging 1.00
R6333:AI182371 UTSW 2 35085269 missense probably damaging 0.99
R6729:AI182371 UTSW 2 35084705 intron probably benign
R6732:AI182371 UTSW 2 35084705 intron probably benign
R6742:AI182371 UTSW 2 35084705 intron probably benign
R7196:AI182371 UTSW 2 35086429 critical splice donor site probably null
R7381:AI182371 UTSW 2 35085359 missense probably damaging 1.00
R7458:AI182371 UTSW 2 35086504 missense possibly damaging 0.95
R7466:AI182371 UTSW 2 35088741 nonsense probably null
RF009:AI182371 UTSW 2 35089197 missense possibly damaging 0.90
Z1177:AI182371 UTSW 2 35095759 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACGAGCTGCCTATGGTTTCC -3'
(R):5'- CACATCCATCTGTCAAGTCACTG -3'

Sequencing Primer
(F):5'- CCTTGACTCTGGACAGGTG -3'
(R):5'- GCTTCTATGAGGGTGCTCCAC -3'
Posted On2019-04-30