Incidental Mutation 'R6781:Mrps33'
ID543665
Institutional Source Beutler Lab
Gene Symbol Mrps33
Ensembl Gene ENSMUSG00000029918
Gene Namemitochondrial ribosomal protein S33
SynonymsPTD003, MRP-S33, Gdap3, CGI-139
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R6781 (G1)
Quality Score70.0074
Status Validated
Chromosome6
Chromosomal Location39801804-39810988 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 39805823 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031978] [ENSMUST00000114797] [ENSMUST00000201461]
Predicted Effect probably benign
Transcript: ENSMUST00000031978
SMART Domains Protein: ENSMUSP00000031978
Gene: ENSMUSG00000029918

DomainStartEndE-ValueType
Pfam:MRP-S33 7 96 2.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114797
Predicted Effect probably benign
Transcript: ENSMUST00000201461
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. The 28S subunit of the mammalian mitoribosome may play a crucial and characteristic role in translation initiation. This gene encodes a 28S subunit protein that is one of the more highly conserved mitochondrial ribosomal proteins among mammals, Drosophila and C. elegans. Splice variants that differ in the 5' UTR have been found for this gene; all variants encode the same protein. Pseudogenes corresponding to this gene are found on chromosomes 1q, 4p, 4q, and 20q [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,374,406 I259N possibly damaging Het
Acot12 G T 13: 91,784,412 probably null Het
AI182371 G T 2: 35,084,705 probably benign Het
Amigo3 T C 9: 108,053,963 L195P probably damaging Het
Aox4 A T 1: 58,245,109 D556V probably benign Het
Arhgef40 A C 14: 51,997,897 probably benign Het
Asb15 T C 6: 24,558,675 V63A probably benign Het
Bicd1 T C 6: 149,513,166 I459T possibly damaging Het
Bub1 C A 2: 127,807,857 G694W probably damaging Het
C4b A T 17: 34,742,954 I106N probably damaging Het
Clca4b T C 3: 144,922,801 I382V probably benign Het
Cntnap5a A C 1: 116,292,397 S646R probably benign Het
Cntnap5c C T 17: 58,138,653 Q563* probably null Het
Cpn1 A G 19: 43,980,904 F107L possibly damaging Het
Csrnp3 T A 2: 66,022,271 C336S probably benign Het
Defa3 T A 8: 21,288,261 M87K probably benign Het
Dmbt1 T C 7: 131,046,561 F274L probably benign Het
Dnah8 TTA TTATA 17: 30,765,724 probably null Het
Dnase2b T C 3: 146,582,371 H323R probably benign Het
Fam83e A T 7: 45,722,147 probably benign Het
Fbn1 T C 2: 125,317,038 N2269S probably damaging Het
Foxa1 A T 12: 57,543,257 M59K possibly damaging Het
Fpr3 T C 17: 17,970,716 V83A probably benign Het
Frmd6 A G 12: 70,899,643 D615G possibly damaging Het
Gfra3 T C 18: 34,711,322 K55R possibly damaging Het
Gm5414 A T 15: 101,625,661 S296T possibly damaging Het
Gtf3c1 T A 7: 125,659,197 K1234* probably null Het
Hltf T A 3: 20,098,166 Y609N probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift74 A G 4: 94,627,302 D152G probably damaging Het
Kcnk6 T C 7: 29,225,055 Y308C probably damaging Het
Klhl29 A G 12: 5,091,347 S546P probably damaging Het
Map7d1 AGGGCAGCC AGGGCAGCCGGGCAGCC 4: 126,240,751 probably null Het
Meis2 T A 2: 116,049,155 H228L probably benign Het
Mfsd10 A T 5: 34,634,509 M344K possibly damaging Het
Olfr1198 A T 2: 88,746,830 N19K probably benign Het
Olfr437 A G 6: 43,167,388 E110G probably damaging Het
Pik3cb T C 9: 99,040,992 T996A possibly damaging Het
Plekha7 A G 7: 116,157,855 probably null Het
Ppp1cb A G 5: 32,480,762 Y86C probably damaging Het
Sass6 T G 3: 116,595,124 probably benign Het
Slc6a15 A T 10: 103,395,067 I218F probably damaging Het
St5 T C 7: 109,525,304 D1110G possibly damaging Het
Tcf23 C T 5: 30,968,960 P61L probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zc3h6 T C 2: 129,015,421 F620S probably damaging Het
Other mutations in Mrps33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Mrps33 APN 6 39802513 nonsense probably null
R0544:Mrps33 UTSW 6 39805554 missense possibly damaging 0.94
R1800:Mrps33 UTSW 6 39802495 missense probably damaging 1.00
R2926:Mrps33 UTSW 6 39805504 missense probably damaging 0.96
R6481:Mrps33 UTSW 6 39805370 critical splice donor site probably null
R6722:Mrps33 UTSW 6 39805665 start gained probably benign
R7440:Mrps33 UTSW 6 39802479 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAGTAGGGAACAGGATTC -3'
(R):5'- CCTTTAGATGGCAAGCAGTCAG -3'

Sequencing Primer
(F):5'- TTAATAGGTGAGCGTGAAAAATCCC -3'
(R):5'- GCAGTCAGCATATTTACTTGCAGAC -3'
Posted On2019-04-30