Incidental Mutation 'R6781:Idh2'
ID543666
Institutional Source Beutler Lab
Gene Symbol Idh2
Ensembl Gene ENSMUSG00000030541
Gene Nameisocitrate dehydrogenase 2 (NADP+), mitochondrial
SynonymsIdh-2, IDPm
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6781 (G1)
Quality Score217.468
Status Validated
Chromosome7
Chromosomal Location80094846-80115392 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) TCCCAGG to T at 80098331 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107384] [ENSMUST00000125542] [ENSMUST00000134328] [ENSMUST00000164056] [ENSMUST00000206714]
Predicted Effect probably benign
Transcript: ENSMUST00000107384
SMART Domains Protein: ENSMUSP00000103007
Gene: ENSMUSG00000030541

DomainStartEndE-ValueType
Iso_dh 49 441 5.32e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134070
Predicted Effect probably benign
Transcript: ENSMUST00000134328
SMART Domains Protein: ENSMUSP00000118184
Gene: ENSMUSG00000030541

DomainStartEndE-ValueType
Iso_dh 49 284 1.59e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156761
Predicted Effect probably benign
Transcript: ENSMUST00000164056
SMART Domains Protein: ENSMUSP00000132361
Gene: ENSMUSG00000048897

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
low complexity region 106 127 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
ZnF_C2H2 297 319 2.71e-2 SMART
ZnF_C2H2 325 347 1.92e-2 SMART
ZnF_C2H2 353 375 2.71e-2 SMART
ZnF_C2H2 381 403 1.18e-2 SMART
ZnF_C2H2 409 431 1.67e-2 SMART
ZnF_C2H2 437 459 4.87e-4 SMART
ZnF_C2H2 465 487 3.83e-2 SMART
ZnF_C2H2 493 515 2.12e-4 SMART
ZnF_C2H2 521 543 3.63e-3 SMART
ZnF_C2H2 549 571 1.58e-3 SMART
ZnF_C2H2 577 600 3.69e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206714
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production. This protein may tightly associate or interact with the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit suppression of tumorigenesis from B16F10 melanoma cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,374,406 I259N possibly damaging Het
Acot12 G T 13: 91,784,412 probably null Het
AI182371 G T 2: 35,084,705 probably benign Het
Amigo3 T C 9: 108,053,963 L195P probably damaging Het
Aox4 A T 1: 58,245,109 D556V probably benign Het
Arhgef40 A C 14: 51,997,897 probably benign Het
Asb15 T C 6: 24,558,675 V63A probably benign Het
Bicd1 T C 6: 149,513,166 I459T possibly damaging Het
Bub1 C A 2: 127,807,857 G694W probably damaging Het
C4b A T 17: 34,742,954 I106N probably damaging Het
Clca4b T C 3: 144,922,801 I382V probably benign Het
Cntnap5a A C 1: 116,292,397 S646R probably benign Het
Cntnap5c C T 17: 58,138,653 Q563* probably null Het
Cpn1 A G 19: 43,980,904 F107L possibly damaging Het
Csrnp3 T A 2: 66,022,271 C336S probably benign Het
Defa3 T A 8: 21,288,261 M87K probably benign Het
Dmbt1 T C 7: 131,046,561 F274L probably benign Het
Dnah8 TTA TTATA 17: 30,765,724 probably null Het
Dnase2b T C 3: 146,582,371 H323R probably benign Het
Fam83e A T 7: 45,722,147 probably benign Het
Fbn1 T C 2: 125,317,038 N2269S probably damaging Het
Foxa1 A T 12: 57,543,257 M59K possibly damaging Het
Fpr3 T C 17: 17,970,716 V83A probably benign Het
Frmd6 A G 12: 70,899,643 D615G possibly damaging Het
Gfra3 T C 18: 34,711,322 K55R possibly damaging Het
Gm5414 A T 15: 101,625,661 S296T possibly damaging Het
Gtf3c1 T A 7: 125,659,197 K1234* probably null Het
Hltf T A 3: 20,098,166 Y609N probably benign Het
Ift74 A G 4: 94,627,302 D152G probably damaging Het
Kcnk6 T C 7: 29,225,055 Y308C probably damaging Het
Klhl29 A G 12: 5,091,347 S546P probably damaging Het
Map7d1 AGGGCAGCC AGGGCAGCCGGGCAGCC 4: 126,240,751 probably null Het
Meis2 T A 2: 116,049,155 H228L probably benign Het
Mfsd10 A T 5: 34,634,509 M344K possibly damaging Het
Mrps33 T C 6: 39,805,823 probably benign Het
Olfr1198 A T 2: 88,746,830 N19K probably benign Het
Olfr437 A G 6: 43,167,388 E110G probably damaging Het
Pik3cb T C 9: 99,040,992 T996A possibly damaging Het
Plekha7 A G 7: 116,157,855 probably null Het
Ppp1cb A G 5: 32,480,762 Y86C probably damaging Het
Sass6 T G 3: 116,595,124 probably benign Het
Slc6a15 A T 10: 103,395,067 I218F probably damaging Het
St5 T C 7: 109,525,304 D1110G possibly damaging Het
Tcf23 C T 5: 30,968,960 P61L probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zc3h6 T C 2: 129,015,421 F620S probably damaging Het
Other mutations in Idh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Idh2 APN 7 80097945 missense probably benign
IGL02281:Idh2 APN 7 80095802 unclassified probably null
IGL02874:Idh2 APN 7 80097873 missense probably damaging 1.00
IGL02892:Idh2 APN 7 80095670 missense probably benign
IGL02937:Idh2 APN 7 80098913 missense probably damaging 1.00
IGL02989:Idh2 APN 7 80099108 missense probably damaging 1.00
R0040:Idh2 UTSW 7 80097822 missense probably damaging 1.00
R0040:Idh2 UTSW 7 80097822 missense probably damaging 1.00
R0090:Idh2 UTSW 7 80097914 missense probably damaging 1.00
R0322:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0384:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0385:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0386:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0387:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0494:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R1603:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1681:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1711:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1844:Idh2 UTSW 7 80098877 missense probably benign 0.31
R3700:Idh2 UTSW 7 80099147 missense probably damaging 1.00
R4941:Idh2 UTSW 7 80096099 missense probably damaging 0.98
R5234:Idh2 UTSW 7 80096105 missense probably damaging 0.99
R5387:Idh2 UTSW 7 80098331 intron probably benign
R5582:Idh2 UTSW 7 80098339 frame shift probably null
R5655:Idh2 UTSW 7 80098248 missense probably damaging 0.99
R6191:Idh2 UTSW 7 80098331 intron probably benign
R6261:Idh2 UTSW 7 80098329 intron probably benign
R6311:Idh2 UTSW 7 80098331 intron probably benign
R6351:Idh2 UTSW 7 80098331 intron probably benign
R6413:Idh2 UTSW 7 80098331 intron probably benign
R6561:Idh2 UTSW 7 80098331 intron probably benign
R6709:Idh2 UTSW 7 80098331 intron probably benign
R6772:Idh2 UTSW 7 80098331 intron probably benign
R6848:Idh2 UTSW 7 80098331 intron probably benign
R6861:Idh2 UTSW 7 80098218 missense probably damaging 1.00
R6899:Idh2 UTSW 7 80098331 intron probably benign
R7063:Idh2 UTSW 7 80095684 missense probably damaging 1.00
R7076:Idh2 UTSW 7 80098331 intron probably benign
R7081:Idh2 UTSW 7 80098329 intron probably benign
R7090:Idh2 UTSW 7 80098331 intron probably benign
R7254:Idh2 UTSW 7 80098331 frame shift probably null
R7298:Idh2 UTSW 7 80098331 intron probably benign
R7401:Idh2 UTSW 7 80098329 intron probably benign
R7560:Idh2 UTSW 7 80098331 frame shift probably null
R7561:Idh2 UTSW 7 80098331 intron probably benign
R7694:Idh2 UTSW 7 80098331 intron probably benign
R7816:Idh2 UTSW 7 80098331 intron probably benign
R7884:Idh2 UTSW 7 80098329 intron probably benign
R7936:Idh2 UTSW 7 80098331 intron probably benign
R7940:Idh2 UTSW 7 80098331 intron probably benign
R7942:Idh2 UTSW 7 80098331 intron probably benign
R7980:Idh2 UTSW 7 80098329 intron probably benign
R8009:Idh2 UTSW 7 80098253 missense probably benign 0.18
R8036:Idh2 UTSW 7 80098331 intron probably benign
RF030:Idh2 UTSW 7 80098329 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGAAGCATCAGAGGTTG -3'
(R):5'- AAACAAGCCTGTACCAGCTATAAGG -3'

Sequencing Primer
(F):5'- GTCAAAGATCTCCTGGAAGATGTC -3'
(R):5'- GCCTGTACCAGCTATAAGGTCTAG -3'
Posted On2019-04-30