Mutagenetix > Incidental Mutation

Incidental Mutation 'R0607:Trpm6'

54367

Institutional Source

Beutler Lab

Gene Symbol

Trpm6

Ensembl Gene

ENSMUSG00000024727

Gene Name

transient receptor potential cation channel, subfamily M, member 6

Synonyms

CHAK2

MMRRC Submission

038796-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0607 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18749983-18892510 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 18872221 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 1704 (T1704N)

Ref Sequence

ENSEMBL: ENSMUSP00000037443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040489]

AlphaFold

Q8CIR4

Predicted Effect

probably benign
Transcript: ENSMUST00000040489
AA Change: T1704N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: T1704N

Domain	Start	End	E-Value	Type
Blast:ANK	430	459	4e-8	BLAST
low complexity region	580	604	N/A	INTRINSIC
transmembrane domain	749	766	N/A	INTRINSIC
Pfam:Ion_trans	847	1087	2.8e-13	PFAM
low complexity region	1113	1126	N/A	INTRINSIC
low complexity region	1136	1154	N/A	INTRINSIC
Pfam:TRPM_tetra	1176	1231	7.5e-27	PFAM
low complexity region	1320	1331	N/A	INTRINSIC
low complexity region	1578	1596	N/A	INTRINSIC
Blast:Alpha_kinase	1618	1673	9e-11	BLAST
low complexity region	1682	1695	N/A	INTRINSIC
Alpha_kinase	1761	1978	1e-84	SMART

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.6%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 147 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900092C05Rik	A	G	7: 12,554,698	E146G	probably benign	Het
4930435E12Rik	A	C	16: 38,828,364	S128A	probably benign	Het
Abca4	G	A	3: 122,156,432	G594S	probably damaging	Het
Acacb	T	C	5: 114,200,301	Y726H	probably damaging	Het
Adam20	T	A	8: 40,795,480	M209K	probably benign	Het
Adam29	A	G	8: 55,873,275	V48A	probably damaging	Het
Adss	A	G	1: 177,767,687	V429A	possibly damaging	Het
Aff1	T	C	5: 103,828,454	S481P	probably damaging	Het
Akr1c19	G	A	13: 4,238,460	A146T	probably benign	Het
Ankhd1	G	T	18: 36,640,280	V59F	probably damaging	Het
Ankmy1	T	G	1: 92,888,675	Y239S	probably damaging	Het
Ankrd24	G	T	10: 81,638,308	C19F	probably damaging	Het
Apaf1	T	C	10: 91,009,203	H1002R	probably damaging	Het
Apc2	T	C	10: 80,314,101	I1663T	probably benign	Het
Apcdd1	A	G	18: 62,951,896	N388S	possibly damaging	Het
Arap2	G	A	5: 62,606,131	P1557S	possibly damaging	Het
Armc2	T	A	10: 41,922,695	H706L	probably benign	Het
Arrb1	T	C	7: 99,588,196		probably null	Het
Atl3	T	C	19: 7,529,666		probably null	Het
B9d2	A	G	7: 25,683,332	T44A	probably damaging	Het
Btbd3	C	T	2: 138,283,816	R307W	possibly damaging	Het
C1galt1	T	C	6: 7,871,193	I343T	probably benign	Het
Cacna1a	A	G	8: 84,629,831	D1901G	probably damaging	Het
Ccdc42	C	T	11: 68,597,710	Q312*	probably null	Het
Cdh18	T	C	15: 23,410,790	Y454H	probably benign	Het
Celf5	G	A	10: 81,466,005	T317I	probably damaging	Het
Celsr2	A	T	3: 108,403,895		probably null	Het
Cenpf	A	T	1: 189,682,463		probably null	Het
Cep350	T	C	1: 155,872,048	D2042G	probably damaging	Het
Chd3	T	C	11: 69,344,358	D2054G	probably damaging	Het
Chgb	A	G	2: 132,793,335	H399R	probably benign	Het
Clp1	C	T	2: 84,725,591	A182T	possibly damaging	Het
Col15a1	A	G	4: 47,282,654	N777S	probably damaging	Het
Coq6	A	G	12: 84,368,638	D145G	possibly damaging	Het
Csf2rb2	T	C	15: 78,287,908	Y325C	probably benign	Het
Ctnna2	T	C	6: 76,902,430	T824A	probably benign	Het
Cyp4x1	T	A	4: 115,112,826	D368V	probably damaging	Het
D10Wsu102e	T	C	10: 83,362,097	S56P	probably benign	Het
D430041D05Rik	C	T	2: 104,233,445	R1354H	probably damaging	Het
D6Ertd527e	A	C	6: 87,111,905	D350A	unknown	Het
Ddx24	A	G	12: 103,419,067	Y426H	possibly damaging	Het
Dexi	G	T	16: 10,542,562	Y43*	probably null	Het
Dgka	A	G	10: 128,720,469		probably null	Het
Dhx38	A	T	8: 109,558,943	D419E	probably benign	Het
Dlg1	C	A	16: 31,665,580	Q9K	probably benign	Het
Dlg1	G	A	16: 31,838,174	V596I	possibly damaging	Het
Dnah11	A	C	12: 118,082,511	W1731G	probably damaging	Het
Dnhd1	T	A	7: 105,720,788	N4473K	probably benign	Het
Dync2h1	A	C	9: 7,051,480	S3152A	probably benign	Het
Egfl7	C	T	2: 26,589,440	T68I	probably damaging	Het
Eif2a	G	A	3: 58,555,652		probably null	Het
Emb	G	A	13: 117,232,750	V56I	possibly damaging	Het
Enpp4	A	T	17: 44,099,495	C397S	probably damaging	Het
Entpd3	A	G	9: 120,557,405	T151A	possibly damaging	Het
Ero1lb	A	G	13: 12,574,866	D50G	probably damaging	Het
Fam219a	A	G	4: 41,520,242	*169Q	probably null	Het
Fga	G	A	3: 83,028,562	G32E	probably damaging	Het
Fkbpl	T	C	17: 34,645,359	F34L	probably benign	Het
Fsd2	T	A	7: 81,545,017	D466V	probably damaging	Het
Gja1	A	G	10: 56,388,070	Y175C	possibly damaging	Het
Gm5478	T	A	15: 101,644,624	I338F	probably damaging	Het
Greb1	T	A	12: 16,682,193	Y1589F	probably damaging	Het
Grk3	C	T	5: 112,920,053	E537K	probably damaging	Het
H2-K1	G	T	17: 33,999,500	D127E	probably damaging	Het
Hcrtr2	A	G	9: 76,230,684	L383P	probably benign	Het
Hmcn1	C	T	1: 150,638,900	V3574M	probably benign	Het
Ikbke	A	T	1: 131,270,184		probably null	Het
Il1r2	A	G	1: 40,105,455	K101E	probably benign	Het
Itga11	A	T	9: 62,774,371	H1054L	probably benign	Het
Kif13a	A	T	13: 46,802,711	V539D	probably damaging	Het
Kifc1	G	A	17: 33,886,647	T62I	probably damaging	Het
Klhl28	A	G	12: 64,951,755	Y322H	probably damaging	Het
Klhl6	C	A	16: 19,957,014	D265Y	possibly damaging	Het
Krt86	T	A	15: 101,479,531	C479S	unknown	Het
Lama2	C	T	10: 27,189,131	R1179H	probably benign	Het
Lce6a	A	T	3: 92,620,328	H57Q	probably benign	Het
Lcn11	T	C	2: 25,779,293	V154A	probably benign	Het
Lnpep	A	T	17: 17,538,554	F843I	probably damaging	Het
Lrrc49	C	T	9: 60,666,357	V281I	probably benign	Het
Lrrtm1	C	A	6: 77,244,628	A356E	probably damaging	Het
Map3k1	A	C	13: 111,763,510	H493Q	probably benign	Het
Mcm4	A	T	16: 15,632,115		probably null	Het
Mdn1	T	A	4: 32,732,829	D3076E	probably benign	Het
Mdn1	C	T	4: 32,712,014	P1844L	probably damaging	Het
Med6	A	T	12: 81,589,024	L27H	probably damaging	Het
Mkl2	A	G	16: 13,381,601	E106G	probably damaging	Het
Myo7a	T	A	7: 98,071,946	T1271S	probably damaging	Het
Myo9a	T	A	9: 59,921,793	M2376K	probably benign	Het
Nell2	G	A	15: 95,229,214	T760I	probably benign	Het
Neurod6	C	T	6: 55,679,587	A22T	probably benign	Het
Nlrp10	T	C	7: 108,924,285	K663E	probably benign	Het
Npr3	T	A	15: 11,845,282	K501N	probably benign	Het
Nr2f2	C	A	7: 70,354,712	R264L	probably damaging	Het
Nup35	T	A	2: 80,642,640	M19K	probably benign	Het
Oacyl	A	T	18: 65,747,891	Q592L	possibly damaging	Het
Olfr1061	T	A	2: 86,413,170	N294I	probably damaging	Het
Olfr1243	A	G	2: 89,528,107	V101A	possibly damaging	Het
Olfr1378	C	A	11: 50,969,843	A275D	possibly damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr1484	T	A	19: 13,586,170	Y289N	probably damaging	Het
Olfr17	T	A	7: 107,097,726	I87K	probably benign	Het
Olfr312	T	A	11: 58,831,972	S273T	probably damaging	Het
Olfr470	A	G	7: 107,845,569	S55P	probably damaging	Het
Olfr56	C	G	11: 49,134,722	H177D	probably damaging	Het
Olfr813	T	G	10: 129,857,201	S228A	possibly damaging	Het
Olfr827	T	C	10: 130,211,070	E20G	probably benign	Het
Patl2	T	C	2: 122,126,669	Y128C	probably benign	Het
Pcdhac2	A	G	18: 37,145,889	I641V	probably benign	Het
Polr2b	T	C	5: 77,313,159		probably benign	Het
Pot1b	A	T	17: 55,665,765	I469N	probably damaging	Het
Prdm11	G	T	2: 93,013,785	D33E	possibly damaging	Het
Prkdc	A	G	16: 15,772,057	S2595G	probably damaging	Het
Prrc1	G	A	18: 57,374,550	V259I	possibly damaging	Het
Prrc2b	G	T	2: 32,213,870	R1120L	probably damaging	Het
Prss38	T	C	11: 59,375,543	S30G	possibly damaging	Het
Raph1	A	T	1: 60,525,869	L153Q	probably damaging	Het
Reck	A	G	4: 43,940,719	T843A	probably benign	Het
Rgs7bp	T	C	13: 104,967,102	N164D	probably benign	Het
Rpusd4	C	A	9: 35,267,993	A35D	possibly damaging	Het
Setd1b	T	C	5: 123,159,951		probably benign	Het
Siglec15	G	T	18: 78,046,137	D297E	probably benign	Het
Skint7	T	A	4: 111,977,459	C13*	probably null	Het
Slc5a12	A	G	2: 110,632,743	M395V	probably benign	Het
Sohlh2	C	A	3: 55,207,683	S363Y	probably damaging	Het
Srgap3	A	T	6: 112,723,119	V966E	probably damaging	Het
Stk4	C	T	2: 164,098,542	P266L	probably damaging	Het
Stxbp5l	G	A	16: 37,142,432	H754Y	probably benign	Het
Synpo2l	A	T	14: 20,660,680	M624K	probably damaging	Het
Tas2r136	T	C	6: 132,777,412	I251V	probably benign	Het
Tecpr1	C	T	5: 144,212,590	V340M	probably damaging	Het
Tecta	C	T	9: 42,388,205	G196S	probably damaging	Het
Thsd7a	T	A	6: 12,331,542		probably null	Het
Timeless	T	C	10: 128,246,334	V577A	probably benign	Het
Tln1	A	T	4: 43,553,071	V340E	probably damaging	Het
Tmem132c	T	A	5: 127,563,553	Y929*	probably null	Het
Tmprss7	C	T	16: 45,669,551	R436Q	probably damaging	Het
Tnik	A	C	3: 28,650,159	K989T	probably damaging	Het
Tnxb	T	A	17: 34,671,918	Y412N	probably damaging	Het
Trmt44	A	G	5: 35,568,759		probably null	Het
Tsc2	A	T	17: 24,621,712	V391E	probably damaging	Het
Ttc22	T	C	4: 106,639,313	V520A	possibly damaging	Het
Ttc3	T	A	16: 94,456,785	Y1650*	probably null	Het
Vmn2r24	A	G	6: 123,786,934	T257A	probably benign	Het
Xab2	A	C	8: 3,613,605	N408K	probably benign	Het
Zbtb42	A	T	12: 112,680,627	Y412F	probably benign	Het
Zfp282	A	G	6: 47,880,369	N179D	probably damaging	Het
Zfp62	C	A	11: 49,215,400	T106K	probably benign	Het

Other mutations in Trpm6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Trpm6	APN	19	18783908	splice site	probably benign
IGL00862:Trpm6	APN	19	18827528	missense	probably damaging	1.00
IGL01348:Trpm6	APN	19	18877651	missense	probably damaging	1.00
IGL01400:Trpm6	APN	19	18825794	nonsense	probably null
IGL01451:Trpm6	APN	19	18809569	missense	probably damaging	1.00
IGL01508:Trpm6	APN	19	18796530	nonsense	probably null
IGL01995:Trpm6	APN	19	18830327	splice site	probably benign
IGL02092:Trpm6	APN	19	18772331	missense	possibly damaging	0.59
IGL02152:Trpm6	APN	19	18832539	missense	possibly damaging	0.93
IGL02294:Trpm6	APN	19	18854063	missense	probably benign
IGL02329:Trpm6	APN	19	18854217	missense	probably benign	0.17
IGL02366:Trpm6	APN	19	18778510	splice site	probably benign
IGL02402:Trpm6	APN	19	18786756	missense	probably benign	0.18
IGL02457:Trpm6	APN	19	18825791	missense	probably damaging	1.00
IGL02457:Trpm6	APN	19	18827398	nonsense	probably null
IGL02684:Trpm6	APN	19	18802207	splice site	probably benign
IGL02705:Trpm6	APN	19	18776733	critical splice donor site	probably null
IGL02728:Trpm6	APN	19	18809652	missense	possibly damaging	0.71
IGL02742:Trpm6	APN	19	18830012	splice site	probably benign
IGL02818:Trpm6	APN	19	18866257	missense	probably benign	0.04
IGL02836:Trpm6	APN	19	18813482	missense	probably damaging	1.00
IGL03119:Trpm6	APN	19	18838017	nonsense	probably null
IGL03193:Trpm6	APN	19	18825872	missense	possibly damaging	0.94
IGL03227:Trpm6	APN	19	18819119	missense	probably benign	0.01
IGL03227:Trpm6	APN	19	18786779	missense	probably benign	0.12
IGL03231:Trpm6	APN	19	18819181	missense	probably benign
IGL03245:Trpm6	APN	19	18877701	missense	probably damaging	1.00
IGL03328:Trpm6	APN	19	18838082	missense	possibly damaging	0.94
IGL03341:Trpm6	APN	19	18813486	missense	probably benign
P0043:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
PIT4260001:Trpm6	UTSW	19	18825802	missense	possibly damaging	0.48
R0057:Trpm6	UTSW	19	18786755	missense	probably benign	0.05
R0115:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R0119:Trpm6	UTSW	19	18832593	missense	probably benign	0.05
R0140:Trpm6	UTSW	19	18819194	splice site	probably null
R0267:Trpm6	UTSW	19	18823378	missense	probably benign
R0350:Trpm6	UTSW	19	18883957	splice site	probably null
R0373:Trpm6	UTSW	19	18853587	missense	probably benign	0.15
R0393:Trpm6	UTSW	19	18778644	missense	probably damaging	0.99
R0416:Trpm6	UTSW	19	18783025	splice site	probably benign
R0505:Trpm6	UTSW	19	18873902	splice site	probably benign
R0526:Trpm6	UTSW	19	18792876	missense	probably damaging	0.97
R0609:Trpm6	UTSW	19	18825862	missense	probably damaging	0.97
R0714:Trpm6	UTSW	19	18838087	missense	possibly damaging	0.90
R1215:Trpm6	UTSW	19	18796498	missense	probably damaging	1.00
R1474:Trpm6	UTSW	19	18796495	missense	probably benign	0.28
R1512:Trpm6	UTSW	19	18875931	missense	probably benign
R1558:Trpm6	UTSW	19	18786828	missense	probably benign	0.04
R1597:Trpm6	UTSW	19	18827524	missense	probably damaging	0.98
R1618:Trpm6	UTSW	19	18877631	missense	possibly damaging	0.88
R1779:Trpm6	UTSW	19	18856217	missense	probably damaging	1.00
R1796:Trpm6	UTSW	19	18827567	missense	possibly damaging	0.90
R1799:Trpm6	UTSW	19	18891999	splice site	probably null
R1840:Trpm6	UTSW	19	18866267	missense	probably benign	0.21
R1991:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2030:Trpm6	UTSW	19	18854265	missense	probably benign
R2073:Trpm6	UTSW	19	18876042	missense	probably damaging	1.00
R2074:Trpm6	UTSW	19	18877739	missense	probably damaging	1.00
R2096:Trpm6	UTSW	19	18825752	missense	probably damaging	0.97
R2103:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2106:Trpm6	UTSW	19	18813350	missense	possibly damaging	0.95
R2117:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R2850:Trpm6	UTSW	19	18792090	missense	possibly damaging	0.68
R3125:Trpm6	UTSW	19	18854431	missense	probably benign	0.05
R3719:Trpm6	UTSW	19	18772393	nonsense	probably null
R3779:Trpm6	UTSW	19	18876039	missense	possibly damaging	0.80
R4115:Trpm6	UTSW	19	18832557	missense	probably damaging	1.00
R4367:Trpm6	UTSW	19	18827525	missense	probably damaging	0.99
R4523:Trpm6	UTSW	19	18796500	missense	probably damaging	1.00
R4546:Trpm6	UTSW	19	18832477	missense	probably damaging	1.00
R4564:Trpm6	UTSW	19	18832597	missense	possibly damaging	0.95
R4565:Trpm6	UTSW	19	18825872	missense	probably damaging	1.00
R4697:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R4714:Trpm6	UTSW	19	18854200	missense	possibly damaging	0.93
R4750:Trpm6	UTSW	19	18876064	missense	probably damaging	0.99
R4771:Trpm6	UTSW	19	18813493	missense	probably damaging	0.97
R4791:Trpm6	UTSW	19	18867981	missense	probably benign	0.00
R4814:Trpm6	UTSW	19	18862212	missense	probably benign	0.11
R5028:Trpm6	UTSW	19	18786760	missense	probably damaging	1.00
R5237:Trpm6	UTSW	19	18813464	missense	probably damaging	1.00
R5615:Trpm6	UTSW	19	18829933	missense	probably damaging	0.96
R5642:Trpm6	UTSW	19	18830207	missense	probably damaging	1.00
R5645:Trpm6	UTSW	19	18853604	missense	probably damaging	1.00
R5726:Trpm6	UTSW	19	18853617	missense	probably damaging	1.00
R5832:Trpm6	UTSW	19	18786819	missense	possibly damaging	0.66
R5843:Trpm6	UTSW	19	18856175	missense	probably benign	0.04
R5955:Trpm6	UTSW	19	18892019	missense	possibly damaging	0.75
R6101:Trpm6	UTSW	19	18853748	nonsense	probably null
R6105:Trpm6	UTSW	19	18853748	nonsense	probably null
R6211:Trpm6	UTSW	19	18783128	missense	probably damaging	1.00
R6228:Trpm6	UTSW	19	18854291	missense	probably damaging	1.00
R6263:Trpm6	UTSW	19	18854108	missense	possibly damaging	0.94
R6453:Trpm6	UTSW	19	18829990	missense	probably damaging	1.00
R6562:Trpm6	UTSW	19	18838042	missense	probably damaging	1.00
R6624:Trpm6	UTSW	19	18796439	critical splice acceptor site	probably null
R6624:Trpm6	UTSW	19	18889020	missense	probably damaging	1.00
R6729:Trpm6	UTSW	19	18830297	missense	probably damaging	1.00
R6765:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
R6976:Trpm6	UTSW	19	18783163	missense	probably benign
R7103:Trpm6	UTSW	19	18813547	missense	possibly damaging	0.87
R7126:Trpm6	UTSW	19	18854033	nonsense	probably null
R7128:Trpm6	UTSW	19	18811773	missense	possibly damaging	0.92
R7157:Trpm6	UTSW	19	18838098	missense	possibly damaging	0.91
R7212:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R7263:Trpm6	UTSW	19	18876786	missense	probably damaging	1.00
R7268:Trpm6	UTSW	19	18778585	missense	probably benign	0.13
R7305:Trpm6	UTSW	19	18876091	missense	probably benign	0.30
R7498:Trpm6	UTSW	19	18876120	missense	probably damaging	1.00
R7558:Trpm6	UTSW	19	18778665	missense	probably damaging	0.96
R7590:Trpm6	UTSW	19	18832581	missense	probably benign	0.31
R7646:Trpm6	UTSW	19	18867961	missense	probably benign	0.10
R7650:Trpm6	UTSW	19	18876013	missense	possibly damaging	0.70
R7727:Trpm6	UTSW	19	18854249	missense	probably damaging	0.97
R7743:Trpm6	UTSW	19	18827408	missense	probably benign	0.03
R7747:Trpm6	UTSW	19	18750045	splice site	probably null
R7807:Trpm6	UTSW	19	18829856	missense	probably benign	0.11
R7870:Trpm6	UTSW	19	18815241	missense	probably benign	0.01
R7891:Trpm6	UTSW	19	18776710	missense	probably benign	0.01
R7955:Trpm6	UTSW	19	18854290	missense	probably benign	0.01
R7965:Trpm6	UTSW	19	18876110	missense	probably damaging	1.00
R7967:Trpm6	UTSW	19	18778659	missense	probably damaging	0.99
R7992:Trpm6	UTSW	19	18815350	missense	probably damaging	1.00
R8035:Trpm6	UTSW	19	18792862	missense	probably damaging	0.97
R8108:Trpm6	UTSW	19	18811790	missense	probably damaging	1.00
R8268:Trpm6	UTSW	19	18873861	missense	possibly damaging	0.85
R8411:Trpm6	UTSW	19	18853968	missense	probably benign	0.39
R8413:Trpm6	UTSW	19	18832485	missense	probably benign	0.00
R8534:Trpm6	UTSW	19	18892095	missense	probably benign	0.00
R8932:Trpm6	UTSW	19	18838002	missense	possibly damaging	0.87
R8990:Trpm6	UTSW	19	18815435	missense	probably damaging	1.00
R9403:Trpm6	UTSW	19	18832652	missense	possibly damaging	0.84
R9446:Trpm6	UTSW	19	18838098	missense	possibly damaging	0.91
R9463:Trpm6	UTSW	19	18783900	critical splice donor site	probably null
R9485:Trpm6	UTSW	19	18778614	missense	probably benign	0.06
R9536:Trpm6	UTSW	19	18786759	missense	probably damaging	1.00
R9549:Trpm6	UTSW	19	18876030	nonsense	probably null
R9564:Trpm6	UTSW	19	18873876	missense	possibly damaging	0.92
R9626:Trpm6	UTSW	19	18813482	missense	probably damaging	1.00
R9655:Trpm6	UTSW	19	18892102	missense	probably benign
R9721:Trpm6	UTSW	19	18829972	missense	probably benign	0.12
R9742:Trpm6	UTSW	19	18823402	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GCAAGCAGCGCAATAATGCACG -3'
(R):5'- AAGGACTTTCAAGTCTGCCCTTTCC -3'

Sequencing Primer
(F):5'- TGCACGAAAGGATATTGGGC -3'
(R):5'- cacttttccagcaaggctc -3'

Posted On

2013-07-11