Incidental Mutation 'R6787:BC035947'
ID543672
Institutional Source Beutler Lab
Gene Symbol BC035947
Ensembl Gene ENSMUSG00000090486
Gene NamecDNA sequence BC035947
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6787 (G1)
Quality Score46.0072
Status Validated
Chromosome1
Chromosomal Location78497026-78512158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78498890 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 335 (P335Q)
Ref Sequence ENSEMBL: ENSMUSP00000132488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170511]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170511
AA Change: P335Q

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132488
Gene: ENSMUSG00000090486
AA Change: P335Q

DomainStartEndE-ValueType
PDB:2M9U|A 43 87 3e-13 PDB
Pfam:TLV_coat 109 691 3.8e-147 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik G A 12: 55,079,983 T32I probably benign Het
4930486L24Rik T A 13: 60,853,108 I205L probably benign Het
Aatk C T 11: 120,010,682 V963M probably damaging Het
Adra1b C A 11: 43,835,415 R225L probably damaging Het
Adrb1 T C 19: 56,722,589 V73A probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
C2cd3 T C 7: 100,455,346 F2189L probably benign Het
Capn9 A G 8: 124,616,185 I635V probably benign Het
Cep55 T A 19: 38,057,926 D42E probably benign Het
Cftr T A 6: 18,274,608 Y878* probably null Het
Clpb A T 7: 101,663,659 probably benign Het
Cpeb3 T C 19: 37,044,689 I569V possibly damaging Het
Cpne6 A T 14: 55,515,244 D297V probably damaging Het
Ddhd1 T C 14: 45,657,519 T165A probably benign Het
Fam98b T C 2: 117,262,921 probably null Het
Frem2 T C 3: 53,654,323 N921S probably benign Het
Gbf1 T A 19: 46,271,772 V1039E probably benign Het
Gmip A G 8: 69,813,786 E212G probably damaging Het
Gpcpd1 C T 2: 132,537,838 probably benign Het
Gtf2ird1 A T 5: 134,363,912 N796K probably damaging Het
Hadhb T C 5: 30,155,249 probably benign Het
Itga4 T A 2: 79,289,265 S472T probably damaging Het
Kcna4 G A 2: 107,295,325 E135K possibly damaging Het
Kmt2c G T 5: 25,275,739 probably null Het
Lama1 T C 17: 67,784,025 I1620T unknown Het
Lins1 A G 7: 66,714,154 E594G probably benign Het
Lrrc38 T A 4: 143,369,794 M225K probably benign Het
Mphosph9 A G 5: 124,261,027 I975T probably damaging Het
Mrgprh T C 17: 12,876,987 F38S probably benign Het
Myo1h G A 5: 114,320,653 G150R probably damaging Het
Oas2 T G 5: 120,738,798 I391L possibly damaging Het
Olfr1242 T A 2: 89,494,034 R93* probably null Het
Olfr18 T C 9: 20,335,925 D14G probably benign Het
Olfr497 T C 7: 108,422,682 I37T possibly damaging Het
Olfr803 T A 10: 129,691,522 D173V possibly damaging Het
Pdcd5 T C 7: 35,642,638 T182A probably damaging Het
Pdlim7 T C 13: 55,508,997 D48G probably damaging Het
Polr3b A C 10: 84,628,625 probably null Het
Psmd5 C T 2: 34,857,637 probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sdhb T C 4: 140,976,190 Y208H probably damaging Het
Serinc5 G A 13: 92,706,232 V397I possibly damaging Het
Sik2 A T 9: 50,998,534 M73K possibly damaging Het
Slc41a1 A G 1: 131,842,749 probably null Het
Slco1a1 T C 6: 141,936,487 I119V probably benign Het
Srd5a1 T C 13: 69,611,299 probably benign Het
Stab2 T C 10: 86,919,084 I1111V probably benign Het
Stxbp6 G T 12: 44,902,996 probably null Het
Tbc1d19 A G 5: 53,835,249 probably null Het
Tnxb A T 17: 34,710,736 T2815S probably benign Het
Txnip T A 3: 96,560,307 I363N probably damaging Het
Zfp442 A T 2: 150,409,579 N134K possibly damaging Het
Other mutations in BC035947
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1853:BC035947 UTSW 1 78499016 missense possibly damaging 0.95
R2079:BC035947 UTSW 1 78511924 utr 5 prime probably benign
R2234:BC035947 UTSW 1 78497962 missense probably damaging 0.98
R2235:BC035947 UTSW 1 78497962 missense probably damaging 0.98
R3840:BC035947 UTSW 1 78497845 missense probably benign 0.00
R3841:BC035947 UTSW 1 78497845 missense probably benign 0.00
R4804:BC035947 UTSW 1 78497876 missense probably damaging 1.00
R4909:BC035947 UTSW 1 78498029 missense probably damaging 0.99
R5139:BC035947 UTSW 1 78499247 missense possibly damaging 0.60
R5302:BC035947 UTSW 1 78511962 start codon destroyed probably null 0.00
R5669:BC035947 UTSW 1 78497913 missense probably damaging 0.98
R5686:BC035947 UTSW 1 78497930 missense probably benign 0.03
R5868:BC035947 UTSW 1 78498323 missense probably damaging 1.00
R5988:BC035947 UTSW 1 78499206 nonsense probably null
R6854:BC035947 UTSW 1 78498488 missense probably damaging 1.00
R7079:BC035947 UTSW 1 78497915 missense probably damaging 1.00
R7168:BC035947 UTSW 1 78499593 missense probably benign 0.04
R7387:BC035947 UTSW 1 78498461 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGCATAGCCAACAGTCCTCT -3'
(R):5'- TTTGCGGTAAATGGGGATGTGAA -3'

Sequencing Primer
(F):5'- AAGTTAAACATTCGCTGTCCCG -3'
(R):5'- TCTGCCTGGGACCTAATCACG -3'
Posted On2019-05-03