Incidental Mutation 'R6787:Gpcpd1'
ID543673
Institutional Source Beutler Lab
Gene Symbol Gpcpd1
Ensembl Gene ENSMUSG00000027346
Gene Nameglycerophosphocholine phosphodiesterase 1
Synonyms2310004G06Rik, 2310032D16Rik, Prei4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R6787 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location132529082-132587729 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 132537838 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028822] [ENSMUST00000060955] [ENSMUST00000110136] [ENSMUST00000110142] [ENSMUST00000145694] [ENSMUST00000148833] [ENSMUST00000149854]
Predicted Effect probably benign
Transcript: ENSMUST00000028822
SMART Domains Protein: ENSMUSP00000028822
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
Pfam:GDPD 142 432 1.3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060955
SMART Domains Protein: ENSMUSP00000062221
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 110 3.78e-29 SMART
low complexity region 142 160 N/A INTRINSIC
low complexity region 167 175 N/A INTRINSIC
Pfam:GDPD 326 615 5.3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110136
SMART Domains Protein: ENSMUSP00000105763
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
Pfam:GDPD 142 431 4.1e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110142
SMART Domains Protein: ENSMUSP00000105769
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 110 3.78e-29 SMART
low complexity region 142 160 N/A INTRINSIC
low complexity region 167 175 N/A INTRINSIC
Pfam:GDPD 326 615 6.1e-63 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124632
AA Change: V23I
Predicted Effect probably benign
Transcript: ENSMUST00000145694
SMART Domains Protein: ENSMUSP00000116457
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 110 3.78e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148833
SMART Domains Protein: ENSMUSP00000116156
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 99 1.02e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149854
SMART Domains Protein: ENSMUSP00000116949
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 94 5.54e-13 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik G A 12: 55,079,983 T32I probably benign Het
4930486L24Rik T A 13: 60,853,108 I205L probably benign Het
Aatk C T 11: 120,010,682 V963M probably damaging Het
Adra1b C A 11: 43,835,415 R225L probably damaging Het
Adrb1 T C 19: 56,722,589 V73A probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
BC035947 G T 1: 78,498,890 P335Q possibly damaging Het
C2cd3 T C 7: 100,455,346 F2189L probably benign Het
Capn9 A G 8: 124,616,185 I635V probably benign Het
Cep55 T A 19: 38,057,926 D42E probably benign Het
Cftr T A 6: 18,274,608 Y878* probably null Het
Clpb A T 7: 101,663,659 probably benign Het
Cpeb3 T C 19: 37,044,689 I569V possibly damaging Het
Cpne6 A T 14: 55,515,244 D297V probably damaging Het
Ddhd1 T C 14: 45,657,519 T165A probably benign Het
Fam98b T C 2: 117,262,921 probably null Het
Frem2 T C 3: 53,654,323 N921S probably benign Het
Gbf1 T A 19: 46,271,772 V1039E probably benign Het
Gmip A G 8: 69,813,786 E212G probably damaging Het
Gtf2ird1 A T 5: 134,363,912 N796K probably damaging Het
Hadhb T C 5: 30,155,249 probably benign Het
Itga4 T A 2: 79,289,265 S472T probably damaging Het
Kcna4 G A 2: 107,295,325 E135K possibly damaging Het
Kmt2c G T 5: 25,275,739 probably null Het
Lama1 T C 17: 67,784,025 I1620T unknown Het
Lins1 A G 7: 66,714,154 E594G probably benign Het
Lrrc38 T A 4: 143,369,794 M225K probably benign Het
Mphosph9 A G 5: 124,261,027 I975T probably damaging Het
Mrgprh T C 17: 12,876,987 F38S probably benign Het
Myo1h G A 5: 114,320,653 G150R probably damaging Het
Oas2 T G 5: 120,738,798 I391L possibly damaging Het
Olfr1242 T A 2: 89,494,034 R93* probably null Het
Olfr18 T C 9: 20,335,925 D14G probably benign Het
Olfr497 T C 7: 108,422,682 I37T possibly damaging Het
Olfr803 T A 10: 129,691,522 D173V possibly damaging Het
Pdcd5 T C 7: 35,642,638 T182A probably damaging Het
Pdlim7 T C 13: 55,508,997 D48G probably damaging Het
Polr3b A C 10: 84,628,625 probably null Het
Psmd5 C T 2: 34,857,637 probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sdhb T C 4: 140,976,190 Y208H probably damaging Het
Serinc5 G A 13: 92,706,232 V397I possibly damaging Het
Sik2 A T 9: 50,998,534 M73K possibly damaging Het
Slc41a1 A G 1: 131,842,749 probably null Het
Slco1a1 T C 6: 141,936,487 I119V probably benign Het
Srd5a1 T C 13: 69,611,299 probably benign Het
Stab2 T C 10: 86,919,084 I1111V probably benign Het
Stxbp6 G T 12: 44,902,996 probably null Het
Tbc1d19 A G 5: 53,835,249 probably null Het
Tnxb A T 17: 34,710,736 T2815S probably benign Het
Txnip T A 3: 96,560,307 I363N probably damaging Het
Zfp442 A T 2: 150,409,579 N134K possibly damaging Het
Other mutations in Gpcpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Gpcpd1 APN 2 132556983 splice site probably null
IGL00672:Gpcpd1 APN 2 132530548 utr 3 prime probably benign
IGL00676:Gpcpd1 APN 2 132554011 missense probably damaging 1.00
IGL00832:Gpcpd1 APN 2 132546850 missense probably damaging 1.00
IGL00931:Gpcpd1 APN 2 132538118 missense probably benign 0.00
IGL01309:Gpcpd1 APN 2 132550324 missense probably damaging 0.97
IGL01960:Gpcpd1 APN 2 132539898 critical splice donor site probably null
IGL02110:Gpcpd1 APN 2 132530610 nonsense probably null
IGL02267:Gpcpd1 APN 2 132568710 missense probably damaging 1.00
IGL02570:Gpcpd1 APN 2 132547685 missense probably benign 0.01
IGL02588:Gpcpd1 APN 2 132534753 missense probably damaging 1.00
IGL03306:Gpcpd1 APN 2 132534073 critical splice donor site probably null
Baependi UTSW 2 132544435 missense probably damaging 1.00
R0413:Gpcpd1 UTSW 2 132564623 splice site probably benign
R1876:Gpcpd1 UTSW 2 132534753 missense probably damaging 1.00
R4276:Gpcpd1 UTSW 2 132540287 missense probably damaging 0.99
R4571:Gpcpd1 UTSW 2 132550350 missense probably benign 0.05
R4849:Gpcpd1 UTSW 2 132534099 missense probably damaging 1.00
R4930:Gpcpd1 UTSW 2 132546874 missense probably damaging 1.00
R5060:Gpcpd1 UTSW 2 132544435 missense probably damaging 1.00
R5081:Gpcpd1 UTSW 2 132547702 missense probably benign 0.17
R5148:Gpcpd1 UTSW 2 132534190 nonsense probably null
R5189:Gpcpd1 UTSW 2 132553972 missense probably damaging 1.00
R5344:Gpcpd1 UTSW 2 132558677 intron probably benign
R5623:Gpcpd1 UTSW 2 132534717 missense probably damaging 1.00
R6086:Gpcpd1 UTSW 2 132538114 missense probably damaging 1.00
R6885:Gpcpd1 UTSW 2 132554074 missense possibly damaging 0.56
R7223:Gpcpd1 UTSW 2 132534056 missense probably benign 0.00
R7261:Gpcpd1 UTSW 2 132568699 missense probably damaging 0.97
X0018:Gpcpd1 UTSW 2 132534769 missense probably damaging 1.00
X0060:Gpcpd1 UTSW 2 132534781 missense probably damaging 1.00
X0066:Gpcpd1 UTSW 2 132544395 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GAGAAGCCTCTTCCATCATCAC -3'
(R):5'- TGGACAGGGCTATTTCATTGATATCTG -3'

Sequencing Primer
(F):5'- AGAAGCCTCTTCCATCATCACATCTC -3'
(R):5'- TGATTTTTCTTATATTCAGTGGGCAC -3'
Posted On2019-05-03