Incidental Mutation 'R0608:Fmo4'
ID 54370
Institutional Source Beutler Lab
Gene Symbol Fmo4
Ensembl Gene ENSMUSG00000026692
Gene Name flavin containing monooxygenase 4
Synonyms
MMRRC Submission 038797-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R0608 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 162620757-162641541 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 162631220 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 249 (R249H)
Ref Sequence ENSEMBL: ENSMUSP00000107150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028014] [ENSMUST00000111525] [ENSMUST00000140274] [ENSMUST00000144916]
AlphaFold Q8VHG0
Predicted Effect possibly damaging
Transcript: ENSMUST00000028014
AA Change: R249H

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028014
Gene: ENSMUSG00000026692
AA Change: R249H

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 4 430 1e-8 PFAM
Pfam:Pyr_redox_3 6 220 5.1e-16 PFAM
Pfam:K_oxygenase 68 227 1.7e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111525
AA Change: R249H

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107150
Gene: ENSMUSG00000026692
AA Change: R249H

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 3 225 1.7e-11 PFAM
Pfam:Pyr_redox_3 6 220 2.5e-9 PFAM
Pfam:K_oxygenase 67 227 6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140031
Predicted Effect probably benign
Transcript: ENSMUST00000140274
SMART Domains Protein: ENSMUSP00000118476
Gene: ENSMUSG00000026692

DomainStartEndE-ValueType
Pfam:FMO-like 2 99 1.5e-57 PFAM
Pfam:NAD_binding_8 7 94 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144916
SMART Domains Protein: ENSMUSP00000119389
Gene: ENSMUSG00000026692

DomainStartEndE-ValueType
Pfam:FMO-like 1 114 2.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193508
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man. This results in a small subpopulation with reduced TMA N-oxidation capacity and causes fish odor syndrome (Trimethylaminuria). Three forms of the enzyme are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A G 14: 78,748,193 (GRCm39) V1398A probably benign Het
Ampd3 C A 7: 110,394,997 (GRCm39) D315E probably damaging Het
Ampd3 T A 7: 110,394,998 (GRCm39) F316I probably damaging Het
Arhgef40 A C 14: 52,234,431 (GRCm39) E911D probably damaging Het
Atxn2l A G 7: 126,100,588 (GRCm39) probably null Het
Bckdhb T G 9: 83,835,789 (GRCm39) F98V probably damaging Het
Calhm1 C T 19: 47,132,280 (GRCm39) V112I probably benign Het
Ccdc28a G A 10: 18,100,699 (GRCm39) R90C probably damaging Het
Cdc40 A T 10: 40,724,048 (GRCm39) Y247N probably benign Het
Cds1 G A 5: 101,962,299 (GRCm39) V305M probably damaging Het
Cep128 T G 12: 90,966,309 (GRCm39) probably benign Het
Cep72 A T 13: 74,186,423 (GRCm39) H249Q probably damaging Het
Cfap70 A T 14: 20,498,631 (GRCm39) Y19N probably damaging Het
Col11a1 T C 3: 114,012,364 (GRCm39) probably benign Het
Cstdc6 T C 16: 36,143,386 (GRCm39) probably null Het
Cysltr1 A G X: 105,622,261 (GRCm39) V75A possibly damaging Het
Dnaaf11 T A 15: 66,252,323 (GRCm39) M448L probably benign Het
Dnah17 G T 11: 117,981,575 (GRCm39) Y1716* probably null Het
Dnm1 T C 2: 32,225,836 (GRCm39) E383G possibly damaging Het
Dst C A 1: 34,329,437 (GRCm39) probably null Het
Edil3 T C 13: 89,332,968 (GRCm39) S375P probably damaging Het
Eme1 A G 11: 94,540,908 (GRCm39) C277R probably damaging Het
Enam T C 5: 88,640,886 (GRCm39) W183R possibly damaging Het
Fbxl6 C T 15: 76,420,953 (GRCm39) V341M probably benign Het
Fgf14 A G 14: 124,914,015 (GRCm39) S39P probably damaging Het
Gle1 T A 2: 29,830,240 (GRCm39) D265E probably benign Het
Gml2 T C 15: 74,693,235 (GRCm39) probably null Het
Golgb1 G T 16: 36,736,692 (GRCm39) E1980* probably null Het
Hap1 A G 11: 100,240,131 (GRCm39) L555P probably damaging Het
Heca T C 10: 17,791,039 (GRCm39) D339G possibly damaging Het
Hepacam2 T C 6: 3,483,479 (GRCm39) T101A possibly damaging Het
Ift88 T C 14: 57,733,678 (GRCm39) V707A probably benign Het
Kdm3a C T 6: 71,597,030 (GRCm39) G252D probably benign Het
Klhl11 A G 11: 100,363,068 (GRCm39) Y163H probably damaging Het
Kntc1 A T 5: 123,924,137 (GRCm39) N1008Y probably damaging Het
Lrp2 G T 2: 69,316,587 (GRCm39) N2131K probably benign Het
Magi3 C G 3: 103,924,873 (GRCm39) G1092A probably damaging Het
Mef2a G T 7: 66,884,896 (GRCm39) S406* probably null Het
Minar2 A G 18: 59,195,531 (GRCm39) probably null Het
Mrps26 G T 2: 130,405,778 (GRCm39) R27L possibly damaging Het
Myof T C 19: 37,904,952 (GRCm39) D1624G probably damaging Het
Naif1 T C 2: 32,344,908 (GRCm39) M204T probably benign Het
Ndufb8 T C 19: 44,538,784 (GRCm39) E179G possibly damaging Het
Neb A T 2: 52,216,769 (GRCm39) D135E probably benign Het
Nlrp6 C T 7: 140,503,399 (GRCm39) Q502* probably null Het
Nploc4 A G 11: 120,304,507 (GRCm39) L238P probably damaging Het
Obi1 T C 14: 104,716,963 (GRCm39) Y470C probably damaging Het
Or4d2 G A 11: 87,784,022 (GRCm39) H243Y probably damaging Het
Parp4 T A 14: 56,839,861 (GRCm39) V523E probably damaging Het
Pdgfra T C 5: 75,324,438 (GRCm39) Y98H probably damaging Het
Plcz1 C T 6: 139,936,459 (GRCm39) R590H probably damaging Het
Pnliprp1 T A 19: 58,726,628 (GRCm39) Y328* probably null Het
Pnpla8 C T 12: 44,330,246 (GRCm39) P48L probably benign Het
Rab44 T A 17: 29,366,317 (GRCm39) probably null Het
Ranbp2 T C 10: 58,329,720 (GRCm39) I3031T probably damaging Het
Sbno1 T C 5: 124,522,604 (GRCm39) D1072G probably damaging Het
Senp7 A G 16: 55,944,236 (GRCm39) T187A possibly damaging Het
Serpinh1 A G 7: 98,998,601 (GRCm39) C10R unknown Het
Sh2d4a A G 8: 68,799,346 (GRCm39) Y405C possibly damaging Het
Slc26a7 T C 4: 14,621,317 (GRCm39) D23G probably benign Het
Slc7a7 A G 14: 54,615,259 (GRCm39) L246P probably damaging Het
Spire1 T C 18: 67,661,945 (GRCm39) R163G probably damaging Het
Stxbp2 T A 8: 3,682,559 (GRCm39) D49E probably damaging Het
Susd2 C T 10: 75,474,069 (GRCm39) A509T probably benign Het
Sycp2 A G 2: 178,024,197 (GRCm39) F396L probably damaging Het
Syne2 T C 12: 76,010,587 (GRCm39) L2499P probably damaging Het
Syt10 C A 15: 89,711,144 (GRCm39) A130S probably benign Het
Sytl4 A T X: 132,862,936 (GRCm39) D16E probably benign Het
Tab2 C T 10: 7,795,883 (GRCm39) V126I probably damaging Het
Tecpr1 T C 5: 144,148,317 (GRCm39) T363A probably damaging Het
Terb2 A G 2: 122,016,816 (GRCm39) D16G probably benign Het
Tm2d2 A G 8: 25,510,552 (GRCm39) E137G probably benign Het
Trim30d T A 7: 104,121,692 (GRCm39) H201L probably damaging Het
Tspan3 A G 9: 56,054,669 (GRCm39) probably null Het
Ttn A T 2: 76,617,667 (GRCm39) L16268Q probably damaging Het
Ttn A T 2: 76,626,529 (GRCm39) probably null Het
Ubap2 T A 4: 41,218,319 (GRCm39) T263S probably benign Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Zeb2 A T 2: 44,886,138 (GRCm39) M973K possibly damaging Het
Zfp229 A G 17: 21,965,615 (GRCm39) E615G probably damaging Het
Zfp655 T A 5: 145,180,867 (GRCm39) S242T possibly damaging Het
Zfp788 T A 7: 41,297,705 (GRCm39) F62I possibly damaging Het
Zmynd8 A G 2: 165,629,078 (GRCm39) probably null Het
Other mutations in Fmo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Fmo4 APN 1 162,621,592 (GRCm39) missense probably benign 0.00
IGL01090:Fmo4 APN 1 162,637,354 (GRCm39) splice site probably null
IGL01295:Fmo4 APN 1 162,626,693 (GRCm39) missense probably damaging 1.00
IGL02089:Fmo4 APN 1 162,626,649 (GRCm39) missense probably benign 0.04
IGL02483:Fmo4 APN 1 162,635,990 (GRCm39) missense possibly damaging 0.60
R0660:Fmo4 UTSW 1 162,637,417 (GRCm39) missense probably benign 0.05
R0737:Fmo4 UTSW 1 162,635,961 (GRCm39) nonsense probably null
R1117:Fmo4 UTSW 1 162,631,232 (GRCm39) missense probably benign 0.03
R1464:Fmo4 UTSW 1 162,621,924 (GRCm39) missense possibly damaging 0.54
R1464:Fmo4 UTSW 1 162,621,924 (GRCm39) missense possibly damaging 0.54
R1577:Fmo4 UTSW 1 162,631,269 (GRCm39) missense possibly damaging 0.50
R1792:Fmo4 UTSW 1 162,621,859 (GRCm39) missense probably benign
R1875:Fmo4 UTSW 1 162,631,187 (GRCm39) missense possibly damaging 0.95
R1929:Fmo4 UTSW 1 162,626,616 (GRCm39) missense possibly damaging 0.95
R1956:Fmo4 UTSW 1 162,631,259 (GRCm39) missense probably benign 0.01
R1957:Fmo4 UTSW 1 162,631,259 (GRCm39) missense probably benign 0.01
R1958:Fmo4 UTSW 1 162,631,259 (GRCm39) missense probably benign 0.01
R2011:Fmo4 UTSW 1 162,626,458 (GRCm39) missense probably damaging 1.00
R2030:Fmo4 UTSW 1 162,621,741 (GRCm39) missense probably damaging 1.00
R2072:Fmo4 UTSW 1 162,637,456 (GRCm39) missense probably benign 0.20
R2272:Fmo4 UTSW 1 162,626,616 (GRCm39) missense possibly damaging 0.95
R3890:Fmo4 UTSW 1 162,621,624 (GRCm39) missense probably benign 0.39
R4255:Fmo4 UTSW 1 162,621,895 (GRCm39) missense probably benign 0.00
R4273:Fmo4 UTSW 1 162,632,748 (GRCm39) missense probably damaging 0.97
R4760:Fmo4 UTSW 1 162,637,396 (GRCm39) missense probably damaging 1.00
R5445:Fmo4 UTSW 1 162,632,842 (GRCm39) missense probably benign 0.24
R5726:Fmo4 UTSW 1 162,635,828 (GRCm39) critical splice donor site probably null
R5786:Fmo4 UTSW 1 162,631,286 (GRCm39) missense probably benign 0.00
R6391:Fmo4 UTSW 1 162,621,538 (GRCm39) nonsense probably null
R6826:Fmo4 UTSW 1 162,631,338 (GRCm39) missense probably damaging 1.00
R7457:Fmo4 UTSW 1 162,621,672 (GRCm39) missense probably benign 0.00
R7913:Fmo4 UTSW 1 162,621,741 (GRCm39) missense possibly damaging 0.69
R8031:Fmo4 UTSW 1 162,626,421 (GRCm39) nonsense probably null
R8055:Fmo4 UTSW 1 162,636,015 (GRCm39) missense probably benign
R8234:Fmo4 UTSW 1 162,632,757 (GRCm39) missense probably damaging 1.00
R8346:Fmo4 UTSW 1 162,621,792 (GRCm39) missense probably benign 0.01
R8706:Fmo4 UTSW 1 162,621,592 (GRCm39) nonsense probably null
R9050:Fmo4 UTSW 1 162,635,099 (GRCm39) missense probably benign 0.15
R9467:Fmo4 UTSW 1 162,631,238 (GRCm39) missense probably benign
R9488:Fmo4 UTSW 1 162,631,337 (GRCm39) missense probably damaging 1.00
R9633:Fmo4 UTSW 1 162,631,191 (GRCm39) missense probably benign 0.00
X0020:Fmo4 UTSW 1 162,621,947 (GRCm39) missense probably benign 0.02
Z1177:Fmo4 UTSW 1 162,631,289 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTACATGCACATATAGAACTCCACTGATAA -3'
(R):5'- AAACTACCAGACCAGAGCctgaaga -3'

Sequencing Primer
(F):5'- CCATGGAATGAAAACTCAAGTACC -3'
(R):5'- gccccaaataaacaaggtagag -3'
Posted On 2013-07-11