Incidental Mutation 'R6973:Zfp687'
ID543701
Institutional Source Beutler Lab
Gene Symbol Zfp687
Ensembl Gene ENSMUSG00000019338
Gene Namezinc finger protein 687
Synonyms4931408L03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.571) question?
Stock #R6973 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95006590-95015448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95009377 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 813 (S813P)
Ref Sequence ENSEMBL: ENSMUSP00000019482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019482] [ENSMUST00000072287] [ENSMUST00000107251] [ENSMUST00000125476] [ENSMUST00000128438] [ENSMUST00000132195] [ENSMUST00000133297] [ENSMUST00000137799] [ENSMUST00000149747] [ENSMUST00000167008]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019482
AA Change: S813P

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000019482
Gene: ENSMUSG00000019338
AA Change: S813P

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
ZnF_C2H2 533 553 4.74e1 SMART
ZnF_C2H2 561 585 1.43e1 SMART
low complexity region 615 634 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
ZnF_C2H2 673 693 7.37e1 SMART
ZnF_C2H2 705 727 1.99e0 SMART
ZnF_C2H2 733 757 3.38e1 SMART
ZnF_C2H2 764 787 2.67e-1 SMART
ZnF_C2H2 792 815 4.4e-2 SMART
ZnF_C2H2 827 849 7.67e-2 SMART
ZnF_C2H2 858 881 2.36e-2 SMART
low complexity region 884 898 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
ZnF_C2H2 964 987 4.05e-1 SMART
ZnF_C2H2 994 1017 1.38e-3 SMART
ZnF_C2H2 1024 1050 4.65e-1 SMART
low complexity region 1057 1075 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
ZnF_C2H2 1135 1158 4.98e-1 SMART
ZnF_C2H2 1200 1222 1.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072287
SMART Domains Protein: ENSMUSP00000072134
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 545 799 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107251
SMART Domains Protein: ENSMUSP00000102872
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 560 814 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125476
SMART Domains Protein: ENSMUSP00000121965
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
SCOP:d1e8xa1 152 243 5e-22 SMART
PI3Kc 572 826 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128438
SMART Domains Protein: ENSMUSP00000119354
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132195
SMART Domains Protein: ENSMUSP00000117308
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133297
SMART Domains Protein: ENSMUSP00000123529
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
PI3Kc 1 225 7.13e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137799
SMART Domains Protein: ENSMUSP00000123335
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
ZnF_C2H2 533 553 4.74e1 SMART
ZnF_C2H2 561 585 1.43e1 SMART
low complexity region 615 634 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
ZnF_C2H2 673 693 7.37e1 SMART
ZnF_C2H2 705 727 1.99e0 SMART
ZnF_C2H2 733 757 3.38e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149747
SMART Domains Protein: ENSMUSP00000116053
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167008
SMART Domains Protein: ENSMUSP00000132150
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
PI3Kc 228 482 6.47e-105 SMART
Meta Mutation Damage Score 0.0963 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes C2H2 zinc finger protein. The encoded protein may play a role in bone differentiation and development. Mutations in this gene are the cause of Paget disease of bone-6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,707 I433T probably benign Het
Aadacl3 T C 4: 144,456,190 Y236C probably benign Het
Adamts12 T A 15: 11,331,780 C1461* probably null Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
Atp6v1c1 A G 15: 38,690,550 N315S probably damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
C2cd4d G T 3: 94,363,823 R132L probably damaging Het
Cd244 A G 1: 171,574,207 Y167C probably damaging Het
Chd4 A G 6: 125,122,862 N1666D possibly damaging Het
Cubn A G 2: 13,381,837 I1539T possibly damaging Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Dgka C T 10: 128,729,594 probably null Het
Ephb4 T G 5: 137,369,804 V737G probably damaging Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Exoc4 G T 6: 33,580,030 C490F probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gpbp1l1 A G 4: 116,581,282 M192V possibly damaging Het
Ireb2 A G 9: 54,882,387 K115R probably benign Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr1038-ps C T 2: 86,122,854 T310I probably benign Het
Olfr652 G A 7: 104,564,976 V252I probably benign Het
Pcdhb2 G C 18: 37,296,363 R463P probably benign Het
Pcdhgb6 A T 18: 37,742,473 D78V possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Prelid3b C A 2: 174,469,362 W59L probably benign Het
Prex2 T G 1: 11,112,743 S405R probably damaging Het
Rp1 G A 1: 4,351,994 Q248* probably null Het
Rspo4 T A 2: 151,867,815 C47S probably damaging Het
Ryr3 C A 2: 112,766,311 M2499I probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Tcn2 T C 11: 3,917,649 *431W probably null Het
Tert A G 13: 73,627,988 E286G probably benign Het
Tnni3 A G 7: 4,518,417 I196T possibly damaging Het
Unc79 T C 12: 102,998,440 I49T possibly damaging Het
Znfx1 T A 2: 167,056,761 H81L probably benign Het
Other mutations in Zfp687
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp687 APN 3 95012416 missense probably damaging 1.00
IGL00510:Zfp687 APN 3 95008447 missense probably damaging 1.00
IGL00824:Zfp687 APN 3 95009185 missense probably damaging 1.00
IGL01861:Zfp687 APN 3 95011860 missense probably damaging 1.00
IGL02167:Zfp687 APN 3 95010530 missense probably benign
IGL02169:Zfp687 APN 3 95011432 missense probably damaging 1.00
IGL02260:Zfp687 APN 3 95011264 missense possibly damaging 0.92
IGL02539:Zfp687 APN 3 95011062 missense probably damaging 0.99
IGL02710:Zfp687 APN 3 95008773 missense probably benign 0.01
IGL02891:Zfp687 APN 3 95011946 missense probably damaging 0.97
IGL03186:Zfp687 APN 3 95011094 missense probably benign
R0006:Zfp687 UTSW 3 95011456 missense probably damaging 0.99
R0006:Zfp687 UTSW 3 95011456 missense probably damaging 0.99
R0243:Zfp687 UTSW 3 95011553 missense probably damaging 0.99
R0556:Zfp687 UTSW 3 95010408 missense probably damaging 1.00
R1111:Zfp687 UTSW 3 95009512 missense probably damaging 1.00
R1170:Zfp687 UTSW 3 95008473 missense probably damaging 1.00
R1236:Zfp687 UTSW 3 95012044 missense probably benign 0.01
R1482:Zfp687 UTSW 3 95007533 missense probably damaging 1.00
R1711:Zfp687 UTSW 3 95011889 missense probably benign 0.00
R2255:Zfp687 UTSW 3 95010437 missense probably damaging 1.00
R3763:Zfp687 UTSW 3 95012080 missense probably damaging 1.00
R3848:Zfp687 UTSW 3 95007914 missense probably damaging 1.00
R3850:Zfp687 UTSW 3 95007914 missense probably damaging 1.00
R4424:Zfp687 UTSW 3 95009128 missense probably damaging 1.00
R4630:Zfp687 UTSW 3 95012488 splice site probably null
R4989:Zfp687 UTSW 3 95010386 missense probably damaging 1.00
R5119:Zfp687 UTSW 3 95011676 missense probably benign 0.28
R5134:Zfp687 UTSW 3 95010386 missense probably damaging 1.00
R5249:Zfp687 UTSW 3 95009466 missense probably damaging 1.00
R5408:Zfp687 UTSW 3 95009275 unclassified probably benign
R5454:Zfp687 UTSW 3 95009146 missense probably damaging 1.00
R5732:Zfp687 UTSW 3 95011217 missense possibly damaging 0.50
R5883:Zfp687 UTSW 3 95012044 missense probably benign 0.01
R6342:Zfp687 UTSW 3 95011877 missense probably benign 0.01
R6395:Zfp687 UTSW 3 95007738 missense possibly damaging 0.48
R6463:Zfp687 UTSW 3 95010784 missense probably damaging 1.00
R6575:Zfp687 UTSW 3 95008389 missense probably damaging 1.00
R6972:Zfp687 UTSW 3 95009377 missense possibly damaging 0.65
R7087:Zfp687 UTSW 3 95010213 missense probably benign 0.08
R7407:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7408:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7483:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7492:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7514:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7849:Zfp687 UTSW 3 95010362 missense possibly damaging 0.65
R8438:Zfp687 UTSW 3 95008122 missense probably benign 0.10
Z1176:Zfp687 UTSW 3 95007701 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAAGTGCTGGTCAAAGTGTGAG -3'
(R):5'- TTGAGATGCCCCTACCTCAC -3'

Sequencing Primer
(F):5'- GTTTGTGAGTGAAGACCGTATCACAC -3'
(R):5'- GATGCCCCTACCTCACTGTCG -3'
Posted On2019-05-13