Incidental Mutation 'R6973:Gpbp1l1'
ID 543702
Institutional Source Beutler Lab
Gene Symbol Gpbp1l1
Ensembl Gene ENSMUSG00000034042
Gene Name GC-rich promoter binding protein 1-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6973 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 116557658-116593882 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 116581282 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 192 (M192V)
Ref Sequence ENSEMBL: ENSMUSP00000102083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030460] [ENSMUST00000106475]
AlphaFold Q6NZP2
Predicted Effect possibly damaging
Transcript: ENSMUST00000030460
AA Change: M192V

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030460
Gene: ENSMUSG00000034042
AA Change: M192V

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 376 470 5.1e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106475
AA Change: M192V

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102083
Gene: ENSMUSG00000034042
AA Change: M192V

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 377 470 1.3e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (37/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,707 I433T probably benign Het
Aadacl3 T C 4: 144,456,190 Y236C probably benign Het
Adamts12 T A 15: 11,331,780 C1461* probably null Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
Atp6v1c1 A G 15: 38,690,550 N315S probably damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
C2cd4d G T 3: 94,363,823 R132L probably damaging Het
Cd244 A G 1: 171,574,207 Y167C probably damaging Het
Chd4 A G 6: 125,122,862 N1666D possibly damaging Het
Cubn A G 2: 13,381,837 I1539T possibly damaging Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Dgka C T 10: 128,729,594 probably null Het
Ephb4 T G 5: 137,369,804 V737G probably damaging Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Exoc4 G T 6: 33,580,030 C490F probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Ireb2 A G 9: 54,882,387 K115R probably benign Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr1038-ps C T 2: 86,122,854 T310I probably benign Het
Olfr652 G A 7: 104,564,976 V252I probably benign Het
Pcdhb2 G C 18: 37,296,363 R463P probably benign Het
Pcdhgb6 A T 18: 37,742,473 D78V possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Prelid3b C A 2: 174,469,362 W59L probably benign Het
Prex2 T G 1: 11,112,743 S405R probably damaging Het
Rp1 G A 1: 4,351,994 Q248* probably null Het
Rspo4 T A 2: 151,867,815 C47S probably damaging Het
Ryr3 C A 2: 112,766,311 M2499I probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Tcn2 T C 11: 3,917,649 *431W probably null Het
Tert A G 13: 73,627,988 E286G probably benign Het
Tnni3 A G 7: 4,518,417 I196T possibly damaging Het
Unc79 T C 12: 102,998,440 I49T possibly damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Znfx1 T A 2: 167,056,761 H81L probably benign Het
Other mutations in Gpbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Gpbp1l1 APN 4 116587513 critical splice donor site probably null
IGL03342:Gpbp1l1 APN 4 116574543 missense probably benign
R0534:Gpbp1l1 UTSW 4 116591268 missense probably damaging 1.00
R0964:Gpbp1l1 UTSW 4 116581239 splice site probably benign
R1136:Gpbp1l1 UTSW 4 116592918 missense probably damaging 1.00
R1169:Gpbp1l1 UTSW 4 116574366 missense possibly damaging 0.53
R3975:Gpbp1l1 UTSW 4 116570985 critical splice donor site probably null
R4296:Gpbp1l1 UTSW 4 116587459 missense possibly damaging 0.80
R4676:Gpbp1l1 UTSW 4 116590265 missense probably damaging 1.00
R4870:Gpbp1l1 UTSW 4 116573517 missense probably benign
R5086:Gpbp1l1 UTSW 4 116588592 missense probably benign 0.04
R5931:Gpbp1l1 UTSW 4 116590260 missense probably benign 0.00
R6486:Gpbp1l1 UTSW 4 116581375 missense probably damaging 0.99
R6604:Gpbp1l1 UTSW 4 116573505 missense probably benign 0.09
R7031:Gpbp1l1 UTSW 4 116592848 missense probably damaging 1.00
R7230:Gpbp1l1 UTSW 4 116588610 missense probably damaging 0.99
R7286:Gpbp1l1 UTSW 4 116590245 missense probably benign 0.02
R7368:Gpbp1l1 UTSW 4 116573458 missense probably benign 0.04
R7791:Gpbp1l1 UTSW 4 116574420 missense probably damaging 1.00
R9475:Gpbp1l1 UTSW 4 116574361 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TATACCCGTGCTTGCATGG -3'
(R):5'- ACTCATACCTTAGAGGGAGGTGG -3'

Sequencing Primer
(F):5'- CGTGCTTGCATGGTAAACAC -3'
(R):5'- CCTTAGAGGGAGGTGGTGCAG -3'
Posted On 2019-05-13