Mutagenetix > Incidental Mutations

Incidental Mutation 'R6973:Ephb4'

543707

Institutional Source

Beutler Lab

Gene Symbol

Ephb4

Ensembl Gene

ENSMUSG00000029710

Gene Name

Eph receptor B4

Synonyms

MDK2, Htk, Myk1, Tyro11

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6973 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

137350109-137378669 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 137369804 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 737 (V737G)

Ref Sequence

ENSEMBL: ENSMUSP00000130275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]

AlphaFold

P54761

Predicted Effect

probably damaging
Transcript: ENSMUST00000061244
AA Change: V737G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: V737G

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111054
AA Change: V737G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: V737G

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	1.4e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	3.4e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
Pfam:SAM_1	882	917	2.6e-7	PFAM
low complexity region	919	934	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111055
AA Change: V746G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: V746G

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	4.2e-10	PFAM
FN3	324	413	1.75e-6	SMART
FN3	443	525	1.07e-10	SMART
Pfam:EphA2_TM	550	621	5e-24	PFAM
TyrKc	624	883	5.09e-130	SMART
SAM	913	980	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000144296
AA Change: V737G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: V737G

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166239
AA Change: V737G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: V737G

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

95% (37/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,742,707	I433T	probably benign	Het
Aadacl3	T	C	4: 144,456,190	Y236C	probably benign	Het
Adamts12	T	A	15: 11,331,780	C1461*	probably null	Het
Akap9	A	G	5: 4,046,699	N2525D	possibly damaging	Het
Atp6v1c1	A	G	15: 38,690,550	N315S	probably damaging	Het
B3gnt7	G	A	1: 86,305,387	M1I	probably null	Het
C2cd4d	G	T	3: 94,363,823	R132L	probably damaging	Het
Cd244	A	G	1: 171,574,207	Y167C	probably damaging	Het
Chd4	A	G	6: 125,122,862	N1666D	possibly damaging	Het
Cubn	A	G	2: 13,381,837	I1539T	possibly damaging	Het
Dcdc2a	A	T	13: 25,120,389		probably benign	Het
Dgka	C	T	10: 128,729,594		probably null	Het
Etv2	T	C	7: 30,634,742	N189D	probably benign	Het
Exoc4	G	T	6: 33,580,030	C490F	probably damaging	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gpbp1l1	A	G	4: 116,581,282	M192V	possibly damaging	Het
Ireb2	A	G	9: 54,882,387	K115R	probably benign	Het
Mybpc1	T	C	10: 88,560,361	E208G	possibly damaging	Het
Nfic	C	A	10: 81,420,357	A158S	probably benign	Het
Nos3	A	T	5: 24,380,243	I798L	probably benign	Het
Ntrk1	A	T	3: 87,783,981	L292Q	probably damaging	Het
Olfr1038-ps	C	T	2: 86,122,854	T310I	probably benign	Het
Olfr652	G	A	7: 104,564,976	V252I	probably benign	Het
Pcdhb2	G	C	18: 37,296,363	R463P	probably benign	Het
Pcdhgb6	A	T	18: 37,742,473	D78V	possibly damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Prelid3b	C	A	2: 174,469,362	W59L	probably benign	Het
Prex2	T	G	1: 11,112,743	S405R	probably damaging	Het
Rp1	G	A	1: 4,351,994	Q248*	probably null	Het
Rspo4	T	A	2: 151,867,815	C47S	probably damaging	Het
Ryr3	C	A	2: 112,766,311	M2499I	probably damaging	Het
Smarca5	A	G	8: 80,704,751	Y946H	probably damaging	Het
Tcn2	T	C	11: 3,917,649	*431W	probably null	Het
Tert	A	G	13: 73,627,988	E286G	probably benign	Het
Tnni3	A	G	7: 4,518,417	I196T	possibly damaging	Het
Unc79	T	C	12: 102,998,440	I49T	possibly damaging	Het
Zfp687	A	G	3: 95,009,377	S813P	possibly damaging	Het
Znfx1	T	A	2: 167,056,761	H81L	probably benign	Het

Other mutations in Ephb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00542:Ephb4	APN	5	137365615	splice site	probably benign
IGL00948:Ephb4	APN	5	137366659	missense	probably damaging	1.00
IGL01653:Ephb4	APN	5	137365741	splice site	probably benign
IGL01885:Ephb4	APN	5	137357797	missense	probably damaging	1.00
IGL01906:Ephb4	APN	5	137361194	missense	probably damaging	1.00
IGL02089:Ephb4	APN	5	137370762	missense	probably damaging	0.98
IGL02216:Ephb4	APN	5	137372070	missense	possibly damaging	0.92
IGL02233:Ephb4	APN	5	137354501	nonsense	probably null
IGL03080:Ephb4	APN	5	137354083	splice site	probably benign
IGL03111:Ephb4	APN	5	137372505	missense	probably benign	0.07
R0599:Ephb4	UTSW	5	137369855	missense	probably damaging	1.00
R0744:Ephb4	UTSW	5	137365667	missense	probably damaging	1.00
R1331:Ephb4	UTSW	5	137366534	splice site	probably benign
R1441:Ephb4	UTSW	5	137361247	missense	probably damaging	1.00
R1732:Ephb4	UTSW	5	137372178	missense	possibly damaging	0.93
R1745:Ephb4	UTSW	5	137360434	missense	probably benign
R1831:Ephb4	UTSW	5	137354415	missense	probably damaging	1.00
R1865:Ephb4	UTSW	5	137363310	missense	possibly damaging	0.53
R2165:Ephb4	UTSW	5	137354426	missense	probably benign	0.08
R2206:Ephb4	UTSW	5	137357719	missense	probably damaging	1.00
R2473:Ephb4	UTSW	5	137365700	missense	probably benign	0.15
R4779:Ephb4	UTSW	5	137365702	missense	probably benign	0.04
R4801:Ephb4	UTSW	5	137365506	missense	probably damaging	1.00
R4802:Ephb4	UTSW	5	137365506	missense	probably damaging	1.00
R5307:Ephb4	UTSW	5	137363312	missense	probably damaging	1.00
R5452:Ephb4	UTSW	5	137361142	missense	probably damaging	1.00
R5458:Ephb4	UTSW	5	137369852	missense	probably damaging	1.00
R5475:Ephb4	UTSW	5	137354439	missense	probably benign	0.00
R5662:Ephb4	UTSW	5	137372195	missense	probably damaging	0.98
R5879:Ephb4	UTSW	5	137360416	missense	probably benign	0.00
R6336:Ephb4	UTSW	5	137372085	missense	probably damaging	1.00
R6443:Ephb4	UTSW	5	137360449	missense	probably damaging	1.00
R6632:Ephb4	UTSW	5	137366587	missense	probably damaging	0.99
R7008:Ephb4	UTSW	5	137361274	missense	probably benign	0.00
R7145:Ephb4	UTSW	5	137372046	missense	probably damaging	1.00
R7421:Ephb4	UTSW	5	137354425	missense	possibly damaging	0.88
R7593:Ephb4	UTSW	5	137361298	missense	probably benign
R7635:Ephb4	UTSW	5	137372103	missense	probably damaging	1.00
R7751:Ephb4	UTSW	5	137365675	missense	probably damaging	1.00
R7825:Ephb4	UTSW	5	137372437	missense	probably damaging	1.00
R8539:Ephb4	UTSW	5	137357855	missense	probably damaging	1.00
R8904:Ephb4	UTSW	5	137370805	missense	probably damaging	1.00
R9228:Ephb4	UTSW	5	137354562	missense	possibly damaging	0.79
R9327:Ephb4	UTSW	5	137363267	missense	probably damaging	0.99
X0026:Ephb4	UTSW	5	137373558	missense	probably damaging	1.00
Z1177:Ephb4	UTSW	5	137361359	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CATGCTGTGTAGACCCCAAG -3'
(R):5'- TGCCAGTACTTCTACCCATGG -3'

Sequencing Primer
(F):5'- CGAGTGATGGCTGTGCTGAAG -3'
(R):5'- AGTACTTCTACCCATGGTTTCTC -3'

Posted On

2019-05-13