Incidental Mutation 'R6973:Exoc4'
ID 543709
Institutional Source Beutler Lab
Gene Symbol Exoc4
Ensembl Gene ENSMUSG00000029763
Gene Name exocyst complex component 4
Synonyms Sec8l1, Sec8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6973 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 33249085-33973979 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 33580030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 490 (C490F)
Ref Sequence ENSEMBL: ENSMUSP00000110732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052266] [ENSMUST00000115080]
AlphaFold O35382
Predicted Effect probably damaging
Transcript: ENSMUST00000052266
AA Change: C490F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051965
Gene: ENSMUSG00000029763
AA Change: C490F

DomainStartEndE-ValueType
Pfam:Sec8_exocyst 28 144 2.4e-21 PFAM
low complexity region 338 346 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115080
AA Change: C490F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110732
Gene: ENSMUSG00000029763
AA Change: C490F

DomainStartEndE-ValueType
Pfam:Sec8_exocyst 24 144 7.4e-37 PFAM
low complexity region 338 346 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic abnormatlities. Gastrulation is not completed and mesoderm formation is abnormal. Death occurs before E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,707 I433T probably benign Het
Aadacl3 T C 4: 144,456,190 Y236C probably benign Het
Adamts12 T A 15: 11,331,780 C1461* probably null Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
Atp6v1c1 A G 15: 38,690,550 N315S probably damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
C2cd4d G T 3: 94,363,823 R132L probably damaging Het
Cd244 A G 1: 171,574,207 Y167C probably damaging Het
Chd4 A G 6: 125,122,862 N1666D possibly damaging Het
Cubn A G 2: 13,381,837 I1539T possibly damaging Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Dgka C T 10: 128,729,594 probably null Het
Ephb4 T G 5: 137,369,804 V737G probably damaging Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gpbp1l1 A G 4: 116,581,282 M192V possibly damaging Het
Ireb2 A G 9: 54,882,387 K115R probably benign Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr1038-ps C T 2: 86,122,854 T310I probably benign Het
Olfr652 G A 7: 104,564,976 V252I probably benign Het
Pcdhb2 G C 18: 37,296,363 R463P probably benign Het
Pcdhgb6 A T 18: 37,742,473 D78V possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Prelid3b C A 2: 174,469,362 W59L probably benign Het
Prex2 T G 1: 11,112,743 S405R probably damaging Het
Rp1 G A 1: 4,351,994 Q248* probably null Het
Rspo4 T A 2: 151,867,815 C47S probably damaging Het
Ryr3 C A 2: 112,766,311 M2499I probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Tcn2 T C 11: 3,917,649 *431W probably null Het
Tert A G 13: 73,627,988 E286G probably benign Het
Tnni3 A G 7: 4,518,417 I196T possibly damaging Het
Unc79 T C 12: 102,998,440 I49T possibly damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Znfx1 T A 2: 167,056,761 H81L probably benign Het
Other mutations in Exoc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Exoc4 APN 6 33918399 critical splice acceptor site probably null
IGL00433:Exoc4 APN 6 33296788 missense probably damaging 1.00
IGL00833:Exoc4 APN 6 33971924 missense probably damaging 1.00
IGL01339:Exoc4 APN 6 33305400 splice site probably benign
IGL01559:Exoc4 APN 6 33266076 missense probably damaging 0.96
IGL01812:Exoc4 APN 6 33757959 splice site probably benign
IGL01926:Exoc4 APN 6 33862142 missense probably damaging 1.00
IGL02270:Exoc4 APN 6 33580026 missense possibly damaging 0.61
IGL02316:Exoc4 APN 6 33910584 missense probably damaging 0.98
IGL02332:Exoc4 APN 6 33249240 critical splice donor site probably null
IGL02668:Exoc4 APN 6 33921532 missense probably benign 0.00
slacker UTSW 6 33758098 missense probably damaging 1.00
R0049:Exoc4 UTSW 6 33296922 splice site probably null
R0134:Exoc4 UTSW 6 33971946 missense possibly damaging 0.56
R0234:Exoc4 UTSW 6 33862087 missense possibly damaging 0.89
R0234:Exoc4 UTSW 6 33862087 missense possibly damaging 0.89
R0538:Exoc4 UTSW 6 33972063 missense probably benign 0.09
R1033:Exoc4 UTSW 6 33265987 missense probably damaging 1.00
R1067:Exoc4 UTSW 6 33918424 missense possibly damaging 0.87
R1109:Exoc4 UTSW 6 33442016 missense probably damaging 1.00
R1768:Exoc4 UTSW 6 33758050 missense probably damaging 1.00
R2013:Exoc4 UTSW 6 33266091 missense probably damaging 0.96
R2078:Exoc4 UTSW 6 33910587 missense probably benign 0.06
R2114:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2115:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2117:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2133:Exoc4 UTSW 6 33758158 missense probably benign 0.00
R2133:Exoc4 UTSW 6 33910538 missense probably benign
R2308:Exoc4 UTSW 6 33918568 missense probably damaging 1.00
R3412:Exoc4 UTSW 6 33265975 missense probably damaging 1.00
R3794:Exoc4 UTSW 6 33475997 missense probably benign
R3885:Exoc4 UTSW 6 33266131 critical splice donor site probably null
R4378:Exoc4 UTSW 6 33815687 missense probably damaging 1.00
R4534:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4535:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4536:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4611:Exoc4 UTSW 6 33438405 missense possibly damaging 0.77
R4617:Exoc4 UTSW 6 33862204 missense probably benign 0.00
R4771:Exoc4 UTSW 6 33441949 critical splice acceptor site probably null
R4851:Exoc4 UTSW 6 33918408 missense probably damaging 0.96
R4921:Exoc4 UTSW 6 33910517 missense probably benign
R5358:Exoc4 UTSW 6 33265999 missense probably damaging 1.00
R5767:Exoc4 UTSW 6 33918432 missense probably benign
R6014:Exoc4 UTSW 6 33475997 missense probably benign
R6132:Exoc4 UTSW 6 33758098 missense probably damaging 1.00
R6164:Exoc4 UTSW 6 33332283 missense probably damaging 0.99
R6583:Exoc4 UTSW 6 33815753 missense probably damaging 1.00
R6915:Exoc4 UTSW 6 33921453 missense possibly damaging 0.81
R7112:Exoc4 UTSW 6 33921488 missense probably damaging 1.00
R7129:Exoc4 UTSW 6 33971999 missense probably damaging 1.00
R7133:Exoc4 UTSW 6 33438473 missense probably benign 0.07
R7547:Exoc4 UTSW 6 33839121 missense possibly damaging 0.95
R7885:Exoc4 UTSW 6 33758066 missense probably benign 0.00
R8024:Exoc4 UTSW 6 33347931 missense probably damaging 1.00
R8053:Exoc4 UTSW 6 33332256 missense probably benign 0.45
R8118:Exoc4 UTSW 6 33971918 missense probably damaging 1.00
R8154:Exoc4 UTSW 6 33910538 missense probably benign
R8485:Exoc4 UTSW 6 33921501 missense probably damaging 1.00
R9226:Exoc4 UTSW 6 33918424 missense possibly damaging 0.87
R9402:Exoc4 UTSW 6 33476143 makesense probably null
R9612:Exoc4 UTSW 6 33249226 missense probably benign 0.19
R9711:Exoc4 UTSW 6 33476056 missense unknown
X0066:Exoc4 UTSW 6 33815690 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGAAGAGAAAGACTGGATCATGTC -3'
(R):5'- TATGGCTGACATTGACTGGTC -3'

Sequencing Primer
(F):5'- GAAAGACTGGATCATGTCTTTTTGC -3'
(R):5'- GCTGACATTGACTGGTCTATTGAC -3'
Posted On 2019-05-13