Mutagenetix > Incidental Mutation

Incidental Mutation 'R6973:Exoc4'

543709

Institutional Source

Beutler Lab

Gene Symbol

Exoc4

Ensembl Gene

ENSMUSG00000029763

Gene Name

exocyst complex component 4

Synonyms

Sec8l1, Sec8

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6973 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33249085-33973979 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 33580030 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 490 (C490F)

Ref Sequence

ENSEMBL: ENSMUSP00000110732 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052266] [ENSMUST00000115080]

AlphaFold

O35382

Predicted Effect

probably damaging
Transcript: ENSMUST00000052266
AA Change: C490F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051965
Gene: ENSMUSG00000029763
AA Change: C490F

Domain	Start	End	E-Value	Type
Pfam:Sec8_exocyst	28	144	2.4e-21	PFAM
low complexity region	338	346	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115080
AA Change: C490F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110732
Gene: ENSMUSG00000029763
AA Change: C490F

Domain	Start	End	E-Value	Type
Pfam:Sec8_exocyst	24	144	7.4e-37	PFAM
low complexity region	338	346	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

95% (37/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic abnormatlities. Gastrulation is not completed and mesoderm formation is abnormal. Death occurs before E10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,742,707	I433T	probably benign	Het
Aadacl3	T	C	4: 144,456,190	Y236C	probably benign	Het
Adamts12	T	A	15: 11,331,780	C1461*	probably null	Het
Akap9	A	G	5: 4,046,699	N2525D	possibly damaging	Het
Atp6v1c1	A	G	15: 38,690,550	N315S	probably damaging	Het
B3gnt7	G	A	1: 86,305,387	M1I	probably null	Het
C2cd4d	G	T	3: 94,363,823	R132L	probably damaging	Het
Cd244	A	G	1: 171,574,207	Y167C	probably damaging	Het
Chd4	A	G	6: 125,122,862	N1666D	possibly damaging	Het
Cubn	A	G	2: 13,381,837	I1539T	possibly damaging	Het
Dcdc2a	A	T	13: 25,120,389		probably benign	Het
Dgka	C	T	10: 128,729,594		probably null	Het
Ephb4	T	G	5: 137,369,804	V737G	probably damaging	Het
Etv2	T	C	7: 30,634,742	N189D	probably benign	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gpbp1l1	A	G	4: 116,581,282	M192V	possibly damaging	Het
Ireb2	A	G	9: 54,882,387	K115R	probably benign	Het
Mybpc1	T	C	10: 88,560,361	E208G	possibly damaging	Het
Nfic	C	A	10: 81,420,357	A158S	probably benign	Het
Nos3	A	T	5: 24,380,243	I798L	probably benign	Het
Ntrk1	A	T	3: 87,783,981	L292Q	probably damaging	Het
Olfr1038-ps	C	T	2: 86,122,854	T310I	probably benign	Het
Olfr652	G	A	7: 104,564,976	V252I	probably benign	Het
Pcdhb2	G	C	18: 37,296,363	R463P	probably benign	Het
Pcdhgb6	A	T	18: 37,742,473	D78V	possibly damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Prelid3b	C	A	2: 174,469,362	W59L	probably benign	Het
Prex2	T	G	1: 11,112,743	S405R	probably damaging	Het
Rp1	G	A	1: 4,351,994	Q248*	probably null	Het
Rspo4	T	A	2: 151,867,815	C47S	probably damaging	Het
Ryr3	C	A	2: 112,766,311	M2499I	probably damaging	Het
Smarca5	A	G	8: 80,704,751	Y946H	probably damaging	Het
Tcn2	T	C	11: 3,917,649	*431W	probably null	Het
Tert	A	G	13: 73,627,988	E286G	probably benign	Het
Tnni3	A	G	7: 4,518,417	I196T	possibly damaging	Het
Unc79	T	C	12: 102,998,440	I49T	possibly damaging	Het
Zfp687	A	G	3: 95,009,377	S813P	possibly damaging	Het
Znfx1	T	A	2: 167,056,761	H81L	probably benign	Het

Other mutations in Exoc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Exoc4	APN	6	33918399	critical splice acceptor site	probably null
IGL00433:Exoc4	APN	6	33296788	missense	probably damaging	1.00
IGL00833:Exoc4	APN	6	33971924	missense	probably damaging	1.00
IGL01339:Exoc4	APN	6	33305400	splice site	probably benign
IGL01559:Exoc4	APN	6	33266076	missense	probably damaging	0.96
IGL01812:Exoc4	APN	6	33757959	splice site	probably benign
IGL01926:Exoc4	APN	6	33862142	missense	probably damaging	1.00
IGL02270:Exoc4	APN	6	33580026	missense	possibly damaging	0.61
IGL02316:Exoc4	APN	6	33910584	missense	probably damaging	0.98
IGL02332:Exoc4	APN	6	33249240	critical splice donor site	probably null
IGL02668:Exoc4	APN	6	33921532	missense	probably benign	0.00
slacker	UTSW	6	33758098	missense	probably damaging	1.00
R0049:Exoc4	UTSW	6	33296922	splice site	probably null
R0134:Exoc4	UTSW	6	33971946	missense	possibly damaging	0.56
R0234:Exoc4	UTSW	6	33862087	missense	possibly damaging	0.89
R0234:Exoc4	UTSW	6	33862087	missense	possibly damaging	0.89
R0538:Exoc4	UTSW	6	33972063	missense	probably benign	0.09
R1033:Exoc4	UTSW	6	33265987	missense	probably damaging	1.00
R1067:Exoc4	UTSW	6	33918424	missense	possibly damaging	0.87
R1109:Exoc4	UTSW	6	33442016	missense	probably damaging	1.00
R1768:Exoc4	UTSW	6	33758050	missense	probably damaging	1.00
R2013:Exoc4	UTSW	6	33266091	missense	probably damaging	0.96
R2078:Exoc4	UTSW	6	33910587	missense	probably benign	0.06
R2114:Exoc4	UTSW	6	33347825	missense	possibly damaging	0.74
R2115:Exoc4	UTSW	6	33347825	missense	possibly damaging	0.74
R2117:Exoc4	UTSW	6	33347825	missense	possibly damaging	0.74
R2133:Exoc4	UTSW	6	33758158	missense	probably benign	0.00
R2133:Exoc4	UTSW	6	33910538	missense	probably benign
R2308:Exoc4	UTSW	6	33918568	missense	probably damaging	1.00
R3412:Exoc4	UTSW	6	33265975	missense	probably damaging	1.00
R3794:Exoc4	UTSW	6	33475997	missense	probably benign
R3885:Exoc4	UTSW	6	33266131	critical splice donor site	probably null
R4378:Exoc4	UTSW	6	33815687	missense	probably damaging	1.00
R4534:Exoc4	UTSW	6	33277244	missense	probably damaging	1.00
R4535:Exoc4	UTSW	6	33277244	missense	probably damaging	1.00
R4536:Exoc4	UTSW	6	33277244	missense	probably damaging	1.00
R4611:Exoc4	UTSW	6	33438405	missense	possibly damaging	0.77
R4617:Exoc4	UTSW	6	33862204	missense	probably benign	0.00
R4771:Exoc4	UTSW	6	33441949	critical splice acceptor site	probably null
R4851:Exoc4	UTSW	6	33918408	missense	probably damaging	0.96
R4921:Exoc4	UTSW	6	33910517	missense	probably benign
R5358:Exoc4	UTSW	6	33265999	missense	probably damaging	1.00
R5767:Exoc4	UTSW	6	33918432	missense	probably benign
R6014:Exoc4	UTSW	6	33475997	missense	probably benign
R6132:Exoc4	UTSW	6	33758098	missense	probably damaging	1.00
R6164:Exoc4	UTSW	6	33332283	missense	probably damaging	0.99
R6583:Exoc4	UTSW	6	33815753	missense	probably damaging	1.00
R6915:Exoc4	UTSW	6	33921453	missense	possibly damaging	0.81
R7112:Exoc4	UTSW	6	33921488	missense	probably damaging	1.00
R7129:Exoc4	UTSW	6	33971999	missense	probably damaging	1.00
R7133:Exoc4	UTSW	6	33438473	missense	probably benign	0.07
R7547:Exoc4	UTSW	6	33839121	missense	possibly damaging	0.95
R7885:Exoc4	UTSW	6	33758066	missense	probably benign	0.00
R8024:Exoc4	UTSW	6	33347931	missense	probably damaging	1.00
R8053:Exoc4	UTSW	6	33332256	missense	probably benign	0.45
R8118:Exoc4	UTSW	6	33971918	missense	probably damaging	1.00
R8154:Exoc4	UTSW	6	33910538	missense	probably benign
R8485:Exoc4	UTSW	6	33921501	missense	probably damaging	1.00
R9226:Exoc4	UTSW	6	33918424	missense	possibly damaging	0.87
R9402:Exoc4	UTSW	6	33476143	makesense	probably null
R9612:Exoc4	UTSW	6	33249226	missense	probably benign	0.19
R9711:Exoc4	UTSW	6	33476056	missense	unknown
X0066:Exoc4	UTSW	6	33815690	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTTGAAGAGAAAGACTGGATCATGTC -3'
(R):5'- TATGGCTGACATTGACTGGTC -3'

Sequencing Primer
(F):5'- GAAAGACTGGATCATGTCTTTTTGC -3'
(R):5'- GCTGACATTGACTGGTCTATTGAC -3'

Posted On

2019-05-13