Incidental Mutation 'R6973:Smarca5'
ID543714
Institutional Source Beutler Lab
Gene Symbol Smarca5
Ensembl Gene ENSMUSG00000031715
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
SynonymsD030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6973 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location80698507-80739497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80704751 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 946 (Y946H)
Ref Sequence ENSEMBL: ENSMUSP00000044361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043359]
Predicted Effect probably damaging
Transcript: ENSMUST00000043359
AA Change: Y946H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: Y946H

DomainStartEndE-ValueType
low complexity region 2 53 N/A INTRINSIC
Pfam:DBINO 65 112 1.1e-4 PFAM
low complexity region 145 156 N/A INTRINSIC
DEXDc 175 367 3.9e-46 SMART
Blast:DEXDc 386 421 6e-11 BLAST
HELICc 512 596 6.2e-28 SMART
low complexity region 756 768 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
SANT 840 889 2.3e-7 SMART
SANT 942 1006 3e-7 SMART
low complexity region 1008 1024 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,707 I433T probably benign Het
Aadacl3 T C 4: 144,456,190 Y236C probably benign Het
Adamts12 T A 15: 11,331,780 C1461* probably null Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
Atp6v1c1 A G 15: 38,690,550 N315S probably damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
C2cd4d G T 3: 94,363,823 R132L probably damaging Het
Cd244 A G 1: 171,574,207 Y167C probably damaging Het
Chd4 A G 6: 125,122,862 N1666D possibly damaging Het
Cubn A G 2: 13,381,837 I1539T possibly damaging Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Dgka C T 10: 128,729,594 probably null Het
Ephb4 T G 5: 137,369,804 V737G probably damaging Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Exoc4 G T 6: 33,580,030 C490F probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gpbp1l1 A G 4: 116,581,282 M192V possibly damaging Het
Ireb2 A G 9: 54,882,387 K115R probably benign Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr1038-ps C T 2: 86,122,854 T310I probably benign Het
Olfr652 G A 7: 104,564,976 V252I probably benign Het
Pcdhb2 G C 18: 37,296,363 R463P probably benign Het
Pcdhgb6 A T 18: 37,742,473 D78V possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Prelid3b C A 2: 174,469,362 W59L probably benign Het
Prex2 T G 1: 11,112,743 S405R probably damaging Het
Rp1 G A 1: 4,351,994 Q248* probably null Het
Rspo4 T A 2: 151,867,815 C47S probably damaging Het
Ryr3 C A 2: 112,766,311 M2499I probably damaging Het
Tcn2 T C 11: 3,917,649 *431W probably null Het
Tert A G 13: 73,627,988 E286G probably benign Het
Tnni3 A G 7: 4,518,417 I196T possibly damaging Het
Unc79 T C 12: 102,998,440 I49T possibly damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Znfx1 T A 2: 167,056,761 H81L probably benign Het
Other mutations in Smarca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Smarca5 APN 8 80714041 missense probably benign 0.10
IGL01138:Smarca5 APN 8 80701076 missense possibly damaging 0.87
IGL01290:Smarca5 APN 8 80727648 missense probably benign
IGL02338:Smarca5 APN 8 80719570 splice site probably benign
IGL03212:Smarca5 APN 8 80711781 missense possibly damaging 0.47
IGL03216:Smarca5 APN 8 80719658 missense probably damaging 1.00
Cipher UTSW 8 80719652 missense probably damaging 1.00
Codebook UTSW 8 80733707 missense probably benign
Codex UTSW 8 80710563 missense probably damaging 0.99
R0254:Smarca5 UTSW 8 80704700 missense probably benign 0.05
R0374:Smarca5 UTSW 8 80736731 missense probably benign 0.30
R0625:Smarca5 UTSW 8 80720686 critical splice donor site probably null
R1065:Smarca5 UTSW 8 80704714 missense probably damaging 1.00
R1164:Smarca5 UTSW 8 80710631 missense probably damaging 1.00
R1709:Smarca5 UTSW 8 80709220 nonsense probably null
R2102:Smarca5 UTSW 8 80704675 missense probably damaging 1.00
R3831:Smarca5 UTSW 8 80728494 missense probably damaging 0.99
R4625:Smarca5 UTSW 8 80710563 missense probably damaging 0.99
R4750:Smarca5 UTSW 8 80733707 missense probably benign
R4822:Smarca5 UTSW 8 80708680 splice site probably null
R4889:Smarca5 UTSW 8 80704697 missense possibly damaging 0.95
R5756:Smarca5 UTSW 8 80710604 missense probably benign
R6120:Smarca5 UTSW 8 80711743 missense probably damaging 0.98
R6582:Smarca5 UTSW 8 80719652 missense probably damaging 1.00
R6939:Smarca5 UTSW 8 80705320 missense possibly damaging 0.63
R6972:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R7027:Smarca5 UTSW 8 80736726 missense probably benign 0.07
R7376:Smarca5 UTSW 8 80726051 missense probably damaging 1.00
R7514:Smarca5 UTSW 8 80717534 missense probably damaging 1.00
R7962:Smarca5 UTSW 8 80736759 missense probably benign
R8031:Smarca5 UTSW 8 80704682 missense probably damaging 1.00
R8400:Smarca5 UTSW 8 80709127 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTGCATTACACAAACCTTGTAC -3'
(R):5'- GACCCCATTTCTTGTAGTCACAAC -3'

Sequencing Primer
(F):5'- ACACTCACCATCGCAGTTCTGG -3'
(R):5'- CCCATTTCTTGTAGTCACAACAATAG -3'
Posted On2019-05-13