Mutagenetix > Incidental Mutation

Incidental Mutation 'R6973:Smarca5'

543714

Institutional Source

Beutler Lab

Gene Symbol

Smarca5

Ensembl Gene

ENSMUSG00000031715

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

Synonyms

D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h

MMRRC Submission

045083-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6973 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80698507-80739497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80704751 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 946 (Y946H)

Ref Sequence

ENSEMBL: ENSMUSP00000044361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043359]

AlphaFold

Q91ZW3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043359
AA Change: Y946H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: Y946H

Domain	Start	End	E-Value	Type
low complexity region	2	53	N/A	INTRINSIC
Pfam:DBINO	65	112	1.1e-4	PFAM
low complexity region	145	156	N/A	INTRINSIC
DEXDc	175	367	3.9e-46	SMART
Blast:DEXDc	386	421	6e-11	BLAST
HELICc	512	596	6.2e-28	SMART
low complexity region	756	768	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
SANT	840	889	2.3e-7	SMART
SANT	942	1006	3e-7	SMART
low complexity region	1008	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.9218

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

95% (37/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,742,707	I433T	probably benign	Het
Aadacl3	T	C	4: 144,456,190	Y236C	probably benign	Het
Adamts12	T	A	15: 11,331,780	C1461*	probably null	Het
Akap9	A	G	5: 4,046,699	N2525D	possibly damaging	Het
Atp6v1c1	A	G	15: 38,690,550	N315S	probably damaging	Het
B3gnt7	G	A	1: 86,305,387	M1I	probably null	Het
C2cd4d	G	T	3: 94,363,823	R132L	probably damaging	Het
Cd244	A	G	1: 171,574,207	Y167C	probably damaging	Het
Chd4	A	G	6: 125,122,862	N1666D	possibly damaging	Het
Cubn	A	G	2: 13,381,837	I1539T	possibly damaging	Het
Dcdc2a	A	T	13: 25,120,389		probably benign	Het
Dgka	C	T	10: 128,729,594		probably null	Het
Ephb4	T	G	5: 137,369,804	V737G	probably damaging	Het
Etv2	T	C	7: 30,634,742	N189D	probably benign	Het
Exoc4	G	T	6: 33,580,030	C490F	probably damaging	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gpbp1l1	A	G	4: 116,581,282	M192V	possibly damaging	Het
Ireb2	A	G	9: 54,882,387	K115R	probably benign	Het
Mybpc1	T	C	10: 88,560,361	E208G	possibly damaging	Het
Nfic	C	A	10: 81,420,357	A158S	probably benign	Het
Nos3	A	T	5: 24,380,243	I798L	probably benign	Het
Ntrk1	A	T	3: 87,783,981	L292Q	probably damaging	Het
Olfr1038-ps	C	T	2: 86,122,854	T310I	probably benign	Het
Olfr652	G	A	7: 104,564,976	V252I	probably benign	Het
Pcdhb2	G	C	18: 37,296,363	R463P	probably benign	Het
Pcdhgb6	A	T	18: 37,742,473	D78V	possibly damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Prelid3b	C	A	2: 174,469,362	W59L	probably benign	Het
Prex2	T	G	1: 11,112,743	S405R	probably damaging	Het
Rp1	G	A	1: 4,351,994	Q248*	probably null	Het
Rspo4	T	A	2: 151,867,815	C47S	probably damaging	Het
Ryr3	C	A	2: 112,766,311	M2499I	probably damaging	Het
Tcn2	T	C	11: 3,917,649	*431W	probably null	Het
Tert	A	G	13: 73,627,988	E286G	probably benign	Het
Tnni3	A	G	7: 4,518,417	I196T	possibly damaging	Het
Unc79	T	C	12: 102,998,440	I49T	possibly damaging	Het
Zfp687	A	G	3: 95,009,377	S813P	possibly damaging	Het
Znfx1	T	A	2: 167,056,761	H81L	probably benign	Het

Other mutations in Smarca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Smarca5	APN	8	80714041	missense	probably benign	0.10
IGL01138:Smarca5	APN	8	80701076	missense	possibly damaging	0.87
IGL01290:Smarca5	APN	8	80727648	missense	probably benign
IGL02338:Smarca5	APN	8	80719570	splice site	probably benign
IGL03212:Smarca5	APN	8	80711781	missense	possibly damaging	0.47
IGL03216:Smarca5	APN	8	80719658	missense	probably damaging	1.00
Cipher	UTSW	8	80719652	missense	probably damaging	1.00
Codebook	UTSW	8	80733707	missense	probably benign
Codex	UTSW	8	80710563	missense	probably damaging	0.99
Encryption	UTSW	8	80704726	missense	probably damaging	1.00
Enigma	UTSW	8	80705332	missense	probably benign	0.35
Key	UTSW	8	80726051	missense	probably damaging	1.00
Sailor	UTSW	8	80736726	missense	probably benign	0.07
Soldier	UTSW	8	80719715	missense	probably damaging	1.00
tinker	UTSW	8	80733750	missense	probably benign
R0254:Smarca5	UTSW	8	80704700	missense	probably benign	0.05
R0374:Smarca5	UTSW	8	80736731	missense	probably benign	0.30
R0625:Smarca5	UTSW	8	80720686	critical splice donor site	probably null
R1065:Smarca5	UTSW	8	80704714	missense	probably damaging	1.00
R1164:Smarca5	UTSW	8	80710631	missense	probably damaging	1.00
R1709:Smarca5	UTSW	8	80709220	nonsense	probably null
R2102:Smarca5	UTSW	8	80704675	missense	probably damaging	1.00
R3831:Smarca5	UTSW	8	80728494	missense	probably damaging	0.99
R4625:Smarca5	UTSW	8	80710563	missense	probably damaging	0.99
R4750:Smarca5	UTSW	8	80733707	missense	probably benign
R4822:Smarca5	UTSW	8	80708680	splice site	probably null
R4889:Smarca5	UTSW	8	80704697	missense	possibly damaging	0.95
R5756:Smarca5	UTSW	8	80710604	missense	probably benign
R6120:Smarca5	UTSW	8	80711743	missense	probably damaging	0.98
R6582:Smarca5	UTSW	8	80719652	missense	probably damaging	1.00
R6939:Smarca5	UTSW	8	80705320	missense	possibly damaging	0.63
R6972:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R7027:Smarca5	UTSW	8	80736726	missense	probably benign	0.07
R7376:Smarca5	UTSW	8	80726051	missense	probably damaging	1.00
R7514:Smarca5	UTSW	8	80717534	missense	probably damaging	1.00
R7962:Smarca5	UTSW	8	80736759	missense	probably benign
R8031:Smarca5	UTSW	8	80704682	missense	probably damaging	1.00
R8400:Smarca5	UTSW	8	80709127	missense	probably benign	0.02
R8798:Smarca5	UTSW	8	80716508	missense	probably damaging	1.00
R8817:Smarca5	UTSW	8	80733750	missense	probably benign
R8824:Smarca5	UTSW	8	80705332	missense	probably benign	0.35
R8905:Smarca5	UTSW	8	80713948	missense	probably benign	0.14
R9018:Smarca5	UTSW	8	80704726	missense	probably damaging	1.00
R9028:Smarca5	UTSW	8	80714013	missense	probably damaging	1.00
R9203:Smarca5	UTSW	8	80704629	nonsense	probably null
R9253:Smarca5	UTSW	8	80719715	missense	probably damaging	1.00
R9294:Smarca5	UTSW	8	80719803	missense	probably damaging	1.00
R9328:Smarca5	UTSW	8	80720749	missense	probably benign	0.00
R9396:Smarca5	UTSW	8	80736729	missense	probably benign	0.00
R9514:Smarca5	UTSW	8	80702211	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGCATTACACAAACCTTGTAC -3'
(R):5'- GACCCCATTTCTTGTAGTCACAAC -3'

Sequencing Primer
(F):5'- ACACTCACCATCGCAGTTCTGG -3'
(R):5'- CCCATTTCTTGTAGTCACAACAATAG -3'

Posted On

2019-05-13