Mutagenetix > Incidental Mutation

Incidental Mutation 'R6973:Mybpc1'

543717

Institutional Source

Beutler Lab

Gene Symbol

Mybpc1

Ensembl Gene

ENSMUSG00000020061

Gene Name

myosin binding protein C, slow-type

Synonyms

8030451F13Rik, Slow-type C-protein

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.887) question?

Stock #

R6973 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88518279-88605152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88560361 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 208 (E208G)

Ref Sequence

ENSEMBL: ENSMUSP00000112615 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]

AlphaFold

A0A571BEN1

Predicted Effect

probably benign
Transcript: ENSMUST00000119185
AA Change: E194G

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: E194G

Domain	Start	End	E-Value	Type
IG	51	147	1.96e-6	SMART
low complexity region	221	233	N/A	INTRINSIC
IG	246	325	4.53e-2	SMART
IG	335	416	1.13e-2	SMART
IG	426	506	6.97e-3	SMART
IG	519	604	2.83e-3	SMART
FN3	607	690	4.28e-10	SMART
FN3	705	788	1.49e-9	SMART
low complexity region	800	812	N/A	INTRINSIC
IG	815	898	9.06e-2	SMART
FN3	901	983	2.06e-12	SMART
IGc2	1028	1095	1.88e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121629
AA Change: E208G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: E208G

Domain	Start	End	E-Value	Type
low complexity region	8	27	N/A	INTRINSIC
IG	65	161	1.96e-6	SMART
low complexity region	235	247	N/A	INTRINSIC
IG	260	339	4.53e-2	SMART
IG	349	430	1.13e-2	SMART
IG	440	520	6.97e-3	SMART
IG	533	618	2.83e-3	SMART
FN3	621	704	4.28e-10	SMART
FN3	719	802	1.49e-9	SMART
low complexity region	814	826	N/A	INTRINSIC
IG	829	912	9.06e-2	SMART
FN3	915	997	2.06e-12	SMART
IGc2	1042	1109	1.88e-8	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

95% (37/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,742,707	I433T	probably benign	Het
Aadacl3	T	C	4: 144,456,190	Y236C	probably benign	Het
Adamts12	T	A	15: 11,331,780	C1461*	probably null	Het
Akap9	A	G	5: 4,046,699	N2525D	possibly damaging	Het
Atp6v1c1	A	G	15: 38,690,550	N315S	probably damaging	Het
B3gnt7	G	A	1: 86,305,387	M1I	probably null	Het
C2cd4d	G	T	3: 94,363,823	R132L	probably damaging	Het
Cd244	A	G	1: 171,574,207	Y167C	probably damaging	Het
Chd4	A	G	6: 125,122,862	N1666D	possibly damaging	Het
Cubn	A	G	2: 13,381,837	I1539T	possibly damaging	Het
Dcdc2a	A	T	13: 25,120,389		probably benign	Het
Dgka	C	T	10: 128,729,594		probably null	Het
Ephb4	T	G	5: 137,369,804	V737G	probably damaging	Het
Etv2	T	C	7: 30,634,742	N189D	probably benign	Het
Exoc4	G	T	6: 33,580,030	C490F	probably damaging	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gpbp1l1	A	G	4: 116,581,282	M192V	possibly damaging	Het
Ireb2	A	G	9: 54,882,387	K115R	probably benign	Het
Nfic	C	A	10: 81,420,357	A158S	probably benign	Het
Nos3	A	T	5: 24,380,243	I798L	probably benign	Het
Ntrk1	A	T	3: 87,783,981	L292Q	probably damaging	Het
Olfr1038-ps	C	T	2: 86,122,854	T310I	probably benign	Het
Olfr652	G	A	7: 104,564,976	V252I	probably benign	Het
Pcdhb2	G	C	18: 37,296,363	R463P	probably benign	Het
Pcdhgb6	A	T	18: 37,742,473	D78V	possibly damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Prelid3b	C	A	2: 174,469,362	W59L	probably benign	Het
Prex2	T	G	1: 11,112,743	S405R	probably damaging	Het
Rp1	G	A	1: 4,351,994	Q248*	probably null	Het
Rspo4	T	A	2: 151,867,815	C47S	probably damaging	Het
Ryr3	C	A	2: 112,766,311	M2499I	probably damaging	Het
Smarca5	A	G	8: 80,704,751	Y946H	probably damaging	Het
Tcn2	T	C	11: 3,917,649	*431W	probably null	Het
Tert	A	G	13: 73,627,988	E286G	probably benign	Het
Tnni3	A	G	7: 4,518,417	I196T	possibly damaging	Het
Unc79	T	C	12: 102,998,440	I49T	possibly damaging	Het
Zfp687	A	G	3: 95,009,377	S813P	possibly damaging	Het
Znfx1	T	A	2: 167,056,761	H81L	probably benign	Het

Other mutations in Mybpc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Mybpc1	APN	10	88549262	missense	probably damaging	0.98
IGL00577:Mybpc1	APN	10	88536384	missense	probably damaging	1.00
IGL00703:Mybpc1	APN	10	88525108	splice site	probably null
IGL00964:Mybpc1	APN	10	88555742	critical splice acceptor site	probably null
IGL01738:Mybpc1	APN	10	88570645	missense	probably damaging	1.00
IGL01978:Mybpc1	APN	10	88531770	missense	probably damaging	1.00
IGL02255:Mybpc1	APN	10	88536428	missense	probably damaging	1.00
IGL02997:Mybpc1	APN	10	88526373	missense	probably damaging	1.00
R0098:Mybpc1	UTSW	10	88529564	missense	probably benign	0.02
R0240:Mybpc1	UTSW	10	88555738	missense	possibly damaging	0.59
R0240:Mybpc1	UTSW	10	88555738	missense	possibly damaging	0.59
R0449:Mybpc1	UTSW	10	88540960	missense	probably damaging	1.00
R0879:Mybpc1	UTSW	10	88571516	splice site	probably benign
R1321:Mybpc1	UTSW	10	88529541	missense	possibly damaging	0.85
R1321:Mybpc1	UTSW	10	88570601	missense	probably damaging	1.00
R1562:Mybpc1	UTSW	10	88553331	missense	probably damaging	1.00
R1783:Mybpc1	UTSW	10	88570568	missense	probably damaging	1.00
R1803:Mybpc1	UTSW	10	88553295	missense	possibly damaging	0.65
R1962:Mybpc1	UTSW	10	88548826	missense	probably damaging	1.00
R1972:Mybpc1	UTSW	10	88551542	missense	probably benign	0.00
R2006:Mybpc1	UTSW	10	88546059	missense	probably damaging	0.99
R2125:Mybpc1	UTSW	10	88573437	nonsense	probably null
R2129:Mybpc1	UTSW	10	88551452	missense	probably damaging	1.00
R2163:Mybpc1	UTSW	10	88540942	splice site	probably benign
R2200:Mybpc1	UTSW	10	88555695	missense	probably damaging	1.00
R2219:Mybpc1	UTSW	10	88555678	missense	probably damaging	1.00
R2270:Mybpc1	UTSW	10	88551407	missense	probably benign	0.01
R2961:Mybpc1	UTSW	10	88531779	missense	probably damaging	1.00
R3767:Mybpc1	UTSW	10	88570659	splice site	probably null
R4032:Mybpc1	UTSW	10	88529564	missense	probably benign	0.02
R4226:Mybpc1	UTSW	10	88573525	nonsense	probably null
R4821:Mybpc1	UTSW	10	88548865	missense	probably damaging	0.98
R4876:Mybpc1	UTSW	10	88522991	missense	probably benign
R4876:Mybpc1	UTSW	10	88536424	missense	probably benign	0.03
R4878:Mybpc1	UTSW	10	88551430	missense	possibly damaging	0.95
R4910:Mybpc1	UTSW	10	88555724	nonsense	probably null
R4913:Mybpc1	UTSW	10	88553254	critical splice donor site	probably null
R4964:Mybpc1	UTSW	10	88555663	missense	probably benign	0.31
R5023:Mybpc1	UTSW	10	88543774	missense	probably damaging	1.00
R5098:Mybpc1	UTSW	10	88546064	missense	probably damaging	1.00
R5196:Mybpc1	UTSW	10	88536351	missense	probably damaging	0.97
R5344:Mybpc1	UTSW	10	88570568	missense	probably damaging	1.00
R5399:Mybpc1	UTSW	10	88523014	missense	probably damaging	1.00
R5538:Mybpc1	UTSW	10	88546029	missense	possibly damaging	0.89
R5808:Mybpc1	UTSW	10	88570566	missense	possibly damaging	0.83
R5970:Mybpc1	UTSW	10	88542456	missense	probably damaging	1.00
R6324:Mybpc1	UTSW	10	88568619	missense	possibly damaging	0.56
R6433:Mybpc1	UTSW	10	88560355	missense	probably damaging	1.00
R6441:Mybpc1	UTSW	10	88553277	missense	probably benign	0.09
R6648:Mybpc1	UTSW	10	88522999	missense	probably damaging	0.96
R6844:Mybpc1	UTSW	10	88536381	missense	possibly damaging	0.50
R6931:Mybpc1	UTSW	10	88542330	nonsense	probably null
R6972:Mybpc1	UTSW	10	88560361	missense	possibly damaging	0.50
R6978:Mybpc1	UTSW	10	88523024	missense	probably damaging	1.00
R7007:Mybpc1	UTSW	10	88553412	missense	probably damaging	1.00
R7019:Mybpc1	UTSW	10	88543719	missense	probably damaging	1.00
R7407:Mybpc1	UTSW	10	88549347	missense	probably damaging	0.99
R7442:Mybpc1	UTSW	10	88526293	missense	probably damaging	1.00
R7577:Mybpc1	UTSW	10	88549325	missense	probably damaging	1.00
R7660:Mybpc1	UTSW	10	88548854	missense	possibly damaging	0.51
R7768:Mybpc1	UTSW	10	88542372	missense	probably damaging	1.00
R7818:Mybpc1	UTSW	10	88558667	missense	probably damaging	1.00
R8171:Mybpc1	UTSW	10	88523003	missense	probably damaging	1.00
R8195:Mybpc1	UTSW	10	88558691	missense	possibly damaging	0.47
R8241:Mybpc1	UTSW	10	88536424	missense	probably benign	0.03
R8360:Mybpc1	UTSW	10	88573497	nonsense	probably null
R8494:Mybpc1	UTSW	10	88526429	missense	probably benign	0.01
R8849:Mybpc1	UTSW	10	88571585	missense	probably benign	0.01
R8936:Mybpc1	UTSW	10	88558575	missense	probably benign	0.44
R9031:Mybpc1	UTSW	10	88523044	missense	probably damaging	0.99
R9061:Mybpc1	UTSW	10	88555639	missense	probably damaging	1.00
R9081:Mybpc1	UTSW	10	88553306	missense	probably damaging	1.00
R9172:Mybpc1	UTSW	10	88543753	missense	possibly damaging	0.93
R9323:Mybpc1	UTSW	10	88524967	critical splice donor site	probably null
R9460:Mybpc1	UTSW	10	88536335	missense	probably damaging	0.99
R9488:Mybpc1	UTSW	10	88543762	missense	possibly damaging	0.47
R9757:Mybpc1	UTSW	10	88536395	missense	probably damaging	1.00
R9796:Mybpc1	UTSW	10	88570635	missense	possibly damaging	0.56
Z1176:Mybpc1	UTSW	10	88560327	missense	probably benign
Z1177:Mybpc1	UTSW	10	88573437	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACACACAGTACTAGGTGGCC -3'
(R):5'- GGAAGACATTTCTGCTCCTCCTAC -3'

Sequencing Primer
(F):5'- ACAGTACTAGGTGGCCCTGTC -3'
(R):5'- CAGTAAAGGTCAAGGGTACATATTTG -3'

Posted On

2019-05-13