Incidental Mutation 'R6973:Mybpc1'
ID 543717
Institutional Source Beutler Lab
Gene Symbol Mybpc1
Ensembl Gene ENSMUSG00000020061
Gene Name myosin binding protein C, slow-type
Synonyms Slow-type C-protein, 8030451F13Rik
MMRRC Submission 045083-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.862) question?
Stock # R6973 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 88354141-88441014 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88396223 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 208 (E208G)
Ref Sequence ENSEMBL: ENSMUSP00000112615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]
AlphaFold A0A571BEN1
Predicted Effect probably benign
Transcript: ENSMUST00000119185
AA Change: E194G

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: E194G

DomainStartEndE-ValueType
IG 51 147 1.96e-6 SMART
low complexity region 221 233 N/A INTRINSIC
IG 246 325 4.53e-2 SMART
IG 335 416 1.13e-2 SMART
IG 426 506 6.97e-3 SMART
IG 519 604 2.83e-3 SMART
FN3 607 690 4.28e-10 SMART
FN3 705 788 1.49e-9 SMART
low complexity region 800 812 N/A INTRINSIC
IG 815 898 9.06e-2 SMART
FN3 901 983 2.06e-12 SMART
IGc2 1028 1095 1.88e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121629
AA Change: E208G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: E208G

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
IG 65 161 1.96e-6 SMART
low complexity region 235 247 N/A INTRINSIC
IG 260 339 4.53e-2 SMART
IG 349 430 1.13e-2 SMART
IG 440 520 6.97e-3 SMART
IG 533 618 2.83e-3 SMART
FN3 621 704 4.28e-10 SMART
FN3 719 802 1.49e-9 SMART
low complexity region 814 826 N/A INTRINSIC
IG 829 912 9.06e-2 SMART
FN3 915 997 2.06e-12 SMART
IGc2 1042 1109 1.88e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,182,760 (GRCm39) Y236C probably benign Het
Adamts12 T A 15: 11,331,866 (GRCm39) C1461* probably null Het
Akap9 A G 5: 4,096,699 (GRCm39) N2525D possibly damaging Het
Atp6v1c1 A G 15: 38,690,794 (GRCm39) N315S probably damaging Het
B3gnt7 G A 1: 86,233,109 (GRCm39) M1I probably null Het
C2cd4d G T 3: 94,271,130 (GRCm39) R132L probably damaging Het
Cd244a A G 1: 171,401,775 (GRCm39) Y167C probably damaging Het
Chd4 A G 6: 125,099,825 (GRCm39) N1666D possibly damaging Het
Cubn A G 2: 13,386,648 (GRCm39) I1539T possibly damaging Het
Dcdc2a A T 13: 25,304,372 (GRCm39) probably benign Het
Dgka C T 10: 128,565,463 (GRCm39) probably null Het
Ephb4 T G 5: 137,368,066 (GRCm39) V737G probably damaging Het
Etv2 T C 7: 30,334,167 (GRCm39) N189D probably benign Het
Exoc4 G T 6: 33,556,965 (GRCm39) C490F probably damaging Het
Gatad1 T C 5: 3,693,540 (GRCm39) R210G probably benign Het
Gpbp1l1 A G 4: 116,438,479 (GRCm39) M192V possibly damaging Het
Ireb2 A G 9: 54,789,671 (GRCm39) K115R probably benign Het
Nfic C A 10: 81,256,191 (GRCm39) A158S probably benign Het
Nos3 A T 5: 24,585,241 (GRCm39) I798L probably benign Het
Ntrk1 A T 3: 87,691,288 (GRCm39) L292Q probably damaging Het
Or52h7 G A 7: 104,214,183 (GRCm39) V252I probably benign Het
Or8u3-ps C T 2: 85,953,198 (GRCm39) T310I probably benign Het
Pcdhb2 G C 18: 37,429,416 (GRCm39) R463P probably benign Het
Pcdhgb6 A T 18: 37,875,526 (GRCm39) D78V possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Prelid3b C A 2: 174,311,155 (GRCm39) W59L probably benign Het
Prex2 T G 1: 11,182,967 (GRCm39) S405R probably damaging Het
Rp1 G A 1: 4,422,217 (GRCm39) Q248* probably null Het
Rspo4 T A 2: 151,709,735 (GRCm39) C47S probably damaging Het
Ryr3 C A 2: 112,596,656 (GRCm39) M2499I probably damaging Het
Smarca5 A G 8: 81,431,380 (GRCm39) Y946H probably damaging Het
Spata31d1e A G 13: 59,890,521 (GRCm39) I433T probably benign Het
Tcn2 T C 11: 3,867,649 (GRCm39) *431W probably null Het
Tert A G 13: 73,776,107 (GRCm39) E286G probably benign Het
Tnni3 A G 7: 4,521,416 (GRCm39) I196T possibly damaging Het
Unc79 T C 12: 102,964,699 (GRCm39) I49T possibly damaging Het
Zfp687 A G 3: 94,916,688 (GRCm39) S813P possibly damaging Het
Znfx1 T A 2: 166,898,681 (GRCm39) H81L probably benign Het
Other mutations in Mybpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mybpc1 APN 10 88,385,124 (GRCm39) missense probably damaging 0.98
IGL00577:Mybpc1 APN 10 88,372,246 (GRCm39) missense probably damaging 1.00
IGL00703:Mybpc1 APN 10 88,360,970 (GRCm39) splice site probably null
IGL00964:Mybpc1 APN 10 88,391,604 (GRCm39) critical splice acceptor site probably null
IGL01738:Mybpc1 APN 10 88,406,507 (GRCm39) missense probably damaging 1.00
IGL01978:Mybpc1 APN 10 88,367,632 (GRCm39) missense probably damaging 1.00
IGL02255:Mybpc1 APN 10 88,372,290 (GRCm39) missense probably damaging 1.00
IGL02997:Mybpc1 APN 10 88,362,235 (GRCm39) missense probably damaging 1.00
R0098:Mybpc1 UTSW 10 88,365,426 (GRCm39) missense probably benign 0.02
R0240:Mybpc1 UTSW 10 88,391,600 (GRCm39) missense possibly damaging 0.59
R0240:Mybpc1 UTSW 10 88,391,600 (GRCm39) missense possibly damaging 0.59
R0449:Mybpc1 UTSW 10 88,376,822 (GRCm39) missense probably damaging 1.00
R0879:Mybpc1 UTSW 10 88,407,378 (GRCm39) splice site probably benign
R1321:Mybpc1 UTSW 10 88,406,463 (GRCm39) missense probably damaging 1.00
R1321:Mybpc1 UTSW 10 88,365,403 (GRCm39) missense possibly damaging 0.85
R1562:Mybpc1 UTSW 10 88,389,193 (GRCm39) missense probably damaging 1.00
R1783:Mybpc1 UTSW 10 88,406,430 (GRCm39) missense probably damaging 1.00
R1803:Mybpc1 UTSW 10 88,389,157 (GRCm39) missense possibly damaging 0.65
R1962:Mybpc1 UTSW 10 88,384,688 (GRCm39) missense probably damaging 1.00
R1972:Mybpc1 UTSW 10 88,387,404 (GRCm39) missense probably benign 0.00
R2006:Mybpc1 UTSW 10 88,381,921 (GRCm39) missense probably damaging 0.99
R2125:Mybpc1 UTSW 10 88,409,299 (GRCm39) nonsense probably null
R2129:Mybpc1 UTSW 10 88,387,314 (GRCm39) missense probably damaging 1.00
R2163:Mybpc1 UTSW 10 88,376,804 (GRCm39) splice site probably benign
R2200:Mybpc1 UTSW 10 88,391,557 (GRCm39) missense probably damaging 1.00
R2219:Mybpc1 UTSW 10 88,391,540 (GRCm39) missense probably damaging 1.00
R2270:Mybpc1 UTSW 10 88,387,269 (GRCm39) missense probably benign 0.01
R2961:Mybpc1 UTSW 10 88,367,641 (GRCm39) missense probably damaging 1.00
R3767:Mybpc1 UTSW 10 88,406,521 (GRCm39) splice site probably null
R4032:Mybpc1 UTSW 10 88,365,426 (GRCm39) missense probably benign 0.02
R4226:Mybpc1 UTSW 10 88,409,387 (GRCm39) nonsense probably null
R4821:Mybpc1 UTSW 10 88,384,727 (GRCm39) missense probably damaging 0.98
R4876:Mybpc1 UTSW 10 88,372,286 (GRCm39) missense probably benign 0.03
R4876:Mybpc1 UTSW 10 88,358,853 (GRCm39) missense probably benign
R4878:Mybpc1 UTSW 10 88,387,292 (GRCm39) missense possibly damaging 0.95
R4910:Mybpc1 UTSW 10 88,391,586 (GRCm39) nonsense probably null
R4913:Mybpc1 UTSW 10 88,389,116 (GRCm39) critical splice donor site probably null
R4964:Mybpc1 UTSW 10 88,391,525 (GRCm39) missense probably benign 0.31
R5023:Mybpc1 UTSW 10 88,379,636 (GRCm39) missense probably damaging 1.00
R5098:Mybpc1 UTSW 10 88,381,926 (GRCm39) missense probably damaging 1.00
R5196:Mybpc1 UTSW 10 88,372,213 (GRCm39) missense probably damaging 0.97
R5344:Mybpc1 UTSW 10 88,406,430 (GRCm39) missense probably damaging 1.00
R5399:Mybpc1 UTSW 10 88,358,876 (GRCm39) missense probably damaging 1.00
R5538:Mybpc1 UTSW 10 88,381,891 (GRCm39) missense possibly damaging 0.89
R5808:Mybpc1 UTSW 10 88,406,428 (GRCm39) missense possibly damaging 0.83
R5970:Mybpc1 UTSW 10 88,378,318 (GRCm39) missense probably damaging 1.00
R6324:Mybpc1 UTSW 10 88,404,481 (GRCm39) missense possibly damaging 0.56
R6433:Mybpc1 UTSW 10 88,396,217 (GRCm39) missense probably damaging 1.00
R6441:Mybpc1 UTSW 10 88,389,139 (GRCm39) missense probably benign 0.09
R6648:Mybpc1 UTSW 10 88,358,861 (GRCm39) missense probably damaging 0.96
R6844:Mybpc1 UTSW 10 88,372,243 (GRCm39) missense possibly damaging 0.50
R6931:Mybpc1 UTSW 10 88,378,192 (GRCm39) nonsense probably null
R6972:Mybpc1 UTSW 10 88,396,223 (GRCm39) missense possibly damaging 0.50
R6978:Mybpc1 UTSW 10 88,358,886 (GRCm39) missense probably damaging 1.00
R7007:Mybpc1 UTSW 10 88,389,274 (GRCm39) missense probably damaging 1.00
R7019:Mybpc1 UTSW 10 88,379,581 (GRCm39) missense probably damaging 1.00
R7407:Mybpc1 UTSW 10 88,385,209 (GRCm39) missense probably damaging 0.99
R7442:Mybpc1 UTSW 10 88,362,155 (GRCm39) missense probably damaging 1.00
R7577:Mybpc1 UTSW 10 88,385,187 (GRCm39) missense probably damaging 1.00
R7660:Mybpc1 UTSW 10 88,384,716 (GRCm39) missense possibly damaging 0.51
R7768:Mybpc1 UTSW 10 88,378,234 (GRCm39) missense probably damaging 1.00
R7818:Mybpc1 UTSW 10 88,394,529 (GRCm39) missense probably damaging 1.00
R8171:Mybpc1 UTSW 10 88,358,865 (GRCm39) missense probably damaging 1.00
R8195:Mybpc1 UTSW 10 88,394,553 (GRCm39) missense possibly damaging 0.47
R8241:Mybpc1 UTSW 10 88,372,286 (GRCm39) missense probably benign 0.03
R8360:Mybpc1 UTSW 10 88,409,359 (GRCm39) nonsense probably null
R8494:Mybpc1 UTSW 10 88,362,291 (GRCm39) missense probably benign 0.01
R8849:Mybpc1 UTSW 10 88,407,447 (GRCm39) missense probably benign 0.01
R8936:Mybpc1 UTSW 10 88,394,437 (GRCm39) missense probably benign 0.44
R9031:Mybpc1 UTSW 10 88,358,906 (GRCm39) missense probably damaging 0.99
R9061:Mybpc1 UTSW 10 88,391,501 (GRCm39) missense probably damaging 1.00
R9081:Mybpc1 UTSW 10 88,389,168 (GRCm39) missense probably damaging 1.00
R9172:Mybpc1 UTSW 10 88,379,615 (GRCm39) missense possibly damaging 0.93
R9323:Mybpc1 UTSW 10 88,360,829 (GRCm39) critical splice donor site probably null
R9460:Mybpc1 UTSW 10 88,372,197 (GRCm39) missense probably damaging 0.99
R9488:Mybpc1 UTSW 10 88,379,624 (GRCm39) missense possibly damaging 0.47
R9757:Mybpc1 UTSW 10 88,372,257 (GRCm39) missense probably damaging 1.00
R9796:Mybpc1 UTSW 10 88,406,497 (GRCm39) missense possibly damaging 0.56
Z1176:Mybpc1 UTSW 10 88,396,189 (GRCm39) missense probably benign
Z1177:Mybpc1 UTSW 10 88,409,299 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACACAGTACTAGGTGGCC -3'
(R):5'- GGAAGACATTTCTGCTCCTCCTAC -3'

Sequencing Primer
(F):5'- ACAGTACTAGGTGGCCCTGTC -3'
(R):5'- CAGTAAAGGTCAAGGGTACATATTTG -3'
Posted On 2019-05-13