Mutagenetix > Incidental Mutation

Incidental Mutation 'R0608:Gle1'

54372

Institutional Source

Beutler Lab

Gene Symbol

Gle1

Ensembl Gene

ENSMUSG00000019715

Gene Name

GLE1 RNA export mediator (yeast)

Synonyms

4933405K21Rik

MMRRC Submission

038797-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0608 (G1)

Quality Score

179

Status

Not validated

Chromosome

Chromosomal Location

29935426-29960371 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 29940228 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 265 (D265E)

Ref Sequence

ENSEMBL: ENSMUSP00000019859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019859]

AlphaFold

Q8R322

Predicted Effect

probably benign
Transcript: ENSMUST00000019859
AA Change: D265E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000019859
Gene: ENSMUSG00000019715
AA Change: D265E

Domain	Start	End	E-Value	Type
low complexity region	67	88	N/A	INTRINSIC
low complexity region	91	105	N/A	INTRINSIC
coiled coil region	154	275	N/A	INTRINSIC
coiled coil region	306	356	N/A	INTRINSIC
Pfam:GLE1	397	650	2.4e-90	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123608

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148983

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149730

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154490

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.7%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted 75-kDa polypeptide with high sequence and structure homology to yeast Gle1p, which is nuclear protein with a leucine-rich nuclear export sequence essential for poly(A)+RNA export. Inhibition of human GLE1L by microinjection of antibodies against GLE1L in HeLa cells resulted in inhibition of poly(A)+RNA export. Immunoflourescence studies show that GLE1L is localized at the nuclear pore complexes. This localization suggests that GLE1L may act at a terminal step in the export of mature RNA messages to the cytoplasm. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730017C20Rik	A	G	18: 59,062,459		probably null	Het
Akap11	A	G	14: 78,510,753	V1398A	probably benign	Het
Ampd3	C	A	7: 110,795,790	D315E	probably damaging	Het
Ampd3	T	A	7: 110,795,791	F316I	probably damaging	Het
Arhgef40	A	C	14: 51,996,974	E911D	probably damaging	Het
Atxn2l	A	G	7: 126,501,416		probably null	Het
BC117090	T	C	16: 36,323,024		probably null	Het
Bckdhb	T	G	9: 83,953,736	F98V	probably damaging	Het
Calhm1	C	T	19: 47,143,841	V112I	probably benign	Het
Ccdc28a	G	A	10: 18,224,951	R90C	probably damaging	Het
Cdc40	A	T	10: 40,848,052	Y247N	probably benign	Het
Cds1	G	A	5: 101,814,433	V305M	probably damaging	Het
Cep128	T	G	12: 90,999,535		probably benign	Het
Cep72	A	T	13: 74,038,304	H249Q	probably damaging	Het
Cfap70	A	T	14: 20,448,563	Y19N	probably damaging	Het
Col11a1	T	C	3: 114,218,715		probably benign	Het
Cysltr1	A	G	X: 106,578,655	V75A	possibly damaging	Het
Dnah17	G	T	11: 118,090,749	Y1716*	probably null	Het
Dnm1	T	C	2: 32,335,824	E383G	possibly damaging	Het
Dst	C	A	1: 34,290,356		probably null	Het
Edil3	T	C	13: 89,184,849	S375P	probably damaging	Het
Eme1	A	G	11: 94,650,082	C277R	probably damaging	Het
Enam	T	C	5: 88,493,027	W183R	possibly damaging	Het
Fbxl6	C	T	15: 76,536,753	V341M	probably benign	Het
Fgf14	A	G	14: 124,676,603	S39P	probably damaging	Het
Fmo4	C	T	1: 162,803,651	R249H	possibly damaging	Het
Gml2	T	C	15: 74,821,386		probably null	Het
Golgb1	G	T	16: 36,916,330	E1980*	probably null	Het
Hap1	A	G	11: 100,349,305	L555P	probably damaging	Het
Heca	T	C	10: 17,915,291	D339G	possibly damaging	Het
Hepacam2	T	C	6: 3,483,479	T101A	possibly damaging	Het
Ift88	T	C	14: 57,496,221	V707A	probably benign	Het
Kdm3a	C	T	6: 71,620,046	G252D	probably benign	Het
Klhl11	A	G	11: 100,472,242	Y163H	probably damaging	Het
Kntc1	A	T	5: 123,786,074	N1008Y	probably damaging	Het
Lrp2	G	T	2: 69,486,243	N2131K	probably benign	Het
Lrrc6	T	A	15: 66,380,474	M448L	probably benign	Het
Magi3	C	G	3: 104,017,557	G1092A	probably damaging	Het
Mef2a	G	T	7: 67,235,148	S406*	probably null	Het
Mrps26	G	T	2: 130,563,858	R27L	possibly damaging	Het
Myof	T	C	19: 37,916,504	D1624G	probably damaging	Het
Naif1	T	C	2: 32,454,896	M204T	probably benign	Het
Ndufb8	T	C	19: 44,550,345	E179G	possibly damaging	Het
Neb	A	T	2: 52,326,757	D135E	probably benign	Het
Nlrp6	C	T	7: 140,923,486	Q502*	probably null	Het
Nploc4	A	G	11: 120,413,681	L238P	probably damaging	Het
Olfr463	G	A	11: 87,893,196	H243Y	probably damaging	Het
Parp4	T	A	14: 56,602,404	V523E	probably damaging	Het
Pdgfra	T	C	5: 75,163,777	Y98H	probably damaging	Het
Plcz1	C	T	6: 139,990,733	R590H	probably damaging	Het
Pnliprp1	T	A	19: 58,738,196	Y328*	probably null	Het
Pnpla8	C	T	12: 44,283,463	P48L	probably benign	Het
Rab44	T	A	17: 29,147,343		probably null	Het
Ranbp2	T	C	10: 58,493,898	I3031T	probably damaging	Het
Rnf219	T	C	14: 104,479,527	Y470C	probably damaging	Het
Sbno1	T	C	5: 124,384,541	D1072G	probably damaging	Het
Senp7	A	G	16: 56,123,873	T187A	possibly damaging	Het
Serpinh1	A	G	7: 99,349,394	C10R	unknown	Het
Sh2d4a	A	G	8: 68,346,694	Y405C	possibly damaging	Het
Slc26a7	T	C	4: 14,621,317	D23G	probably benign	Het
Slc7a7	A	G	14: 54,377,802	L246P	probably damaging	Het
Spire1	T	C	18: 67,528,875	R163G	probably damaging	Het
Stxbp2	T	A	8: 3,632,559	D49E	probably damaging	Het
Susd2	C	T	10: 75,638,235	A509T	probably benign	Het
Sycp2	A	G	2: 178,382,404	F396L	probably damaging	Het
Syne2	T	C	12: 75,963,813	L2499P	probably damaging	Het
Syt10	C	A	15: 89,826,941	A130S	probably benign	Het
Sytl4	A	T	X: 133,962,187	D16E	probably benign	Het
Tab2	C	T	10: 7,920,119	V126I	probably damaging	Het
Tecpr1	T	C	5: 144,211,499	T363A	probably damaging	Het
Terb2	A	G	2: 122,186,335	D16G	probably benign	Het
Tm2d2	A	G	8: 25,020,536	E137G	probably benign	Het
Trim30d	T	A	7: 104,472,485	H201L	probably damaging	Het
Tspan3	A	G	9: 56,147,385		probably null	Het
Ttn	A	T	2: 76,787,323	L16268Q	probably damaging	Het
Ttn	A	T	2: 76,796,185		probably null	Het
Ubap2	T	A	4: 41,218,319	T263S	probably benign	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Zeb2	A	T	2: 44,996,126	M973K	possibly damaging	Het
Zfp229	A	G	17: 21,746,634	E615G	probably damaging	Het
Zfp655	T	A	5: 145,244,057	S242T	possibly damaging	Het
Zfp788	T	A	7: 41,648,281	F62I	possibly damaging	Het
Zmynd8	A	G	2: 165,787,158		probably null	Het

Other mutations in Gle1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Gle1	APN	2	29939289	splice site	probably benign
IGL01880:Gle1	APN	2	29943750	missense	possibly damaging	0.53
IGL02293:Gle1	APN	2	29957760	missense	probably benign	0.00
IGL02859:Gle1	APN	2	29949228	missense	probably damaging	1.00
IGL03368:Gle1	APN	2	29943793	missense	probably damaging	1.00
R0535:Gle1	UTSW	2	29957805	missense	probably damaging	1.00
R0839:Gle1	UTSW	2	29958450	missense	probably benign	0.28
R0908:Gle1	UTSW	2	29936121	missense	probably benign	0.06
R1102:Gle1	UTSW	2	29944054	missense	possibly damaging	0.88
R1202:Gle1	UTSW	2	29949265	missense	probably damaging	1.00
R1302:Gle1	UTSW	2	29952552	splice site	probably null
R2184:Gle1	UTSW	2	29949018	missense	probably damaging	1.00
R2213:Gle1	UTSW	2	29949301	missense	probably damaging	0.97
R4151:Gle1	UTSW	2	29944044	missense	probably damaging	1.00
R4172:Gle1	UTSW	2	29938526	missense	probably benign
R4732:Gle1	UTSW	2	29940232	missense	probably damaging	0.96
R4733:Gle1	UTSW	2	29940232	missense	probably damaging	0.96
R4775:Gle1	UTSW	2	29936061	missense	possibly damaging	0.86
R4817:Gle1	UTSW	2	29936211	missense	probably benign	0.00
R4824:Gle1	UTSW	2	29940203	missense	possibly damaging	0.82
R4869:Gle1	UTSW	2	29936020	missense	possibly damaging	0.69
R4909:Gle1	UTSW	2	29936080	missense	probably benign	0.01
R5036:Gle1	UTSW	2	29936211	missense	probably benign	0.00
R5298:Gle1	UTSW	2	29948943	missense	probably benign	0.02
R5903:Gle1	UTSW	2	29940281	missense	probably benign	0.00
R6345:Gle1	UTSW	2	29936115	missense	probably benign	0.00
R6529:Gle1	UTSW	2	29935527	missense	possibly damaging	0.56
R7144:Gle1	UTSW	2	29943793	missense	probably damaging	1.00
R7984:Gle1	UTSW	2	29938576	missense	probably damaging	0.99
R8154:Gle1	UTSW	2	29938607	critical splice donor site	probably null
R8203:Gle1	UTSW	2	29935510	missense	probably benign
R8348:Gle1	UTSW	2	29942544	missense	possibly damaging	0.86
R9276:Gle1	UTSW	2	29939502	missense	possibly damaging	0.51
R9367:Gle1	UTSW	2	29949002	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTGACTGACTTAGTGCCCCTTTC -3'
(R):5'- TCCCAATGCCCAATGGCTTCATATC -3'

Sequencing Primer
(F):5'- CAGTAGATTCTCAACCTAAAGCTTCG -3'
(R):5'- ctcaaactcagaaatccgcc -3'

Posted On

2013-07-11