Incidental Mutation 'R6973:Adamts12'
ID 543723
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 12
Synonyms
MMRRC Submission 045083-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R6973 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 11064876-11349317 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 11331866 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 1461 (C1461*)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
AlphaFold Q811B3
Predicted Effect probably null
Transcript: ENSMUST00000061318
AA Change: C1461*
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: C1461*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,182,760 (GRCm39) Y236C probably benign Het
Akap9 A G 5: 4,096,699 (GRCm39) N2525D possibly damaging Het
Atp6v1c1 A G 15: 38,690,794 (GRCm39) N315S probably damaging Het
B3gnt7 G A 1: 86,233,109 (GRCm39) M1I probably null Het
C2cd4d G T 3: 94,271,130 (GRCm39) R132L probably damaging Het
Cd244a A G 1: 171,401,775 (GRCm39) Y167C probably damaging Het
Chd4 A G 6: 125,099,825 (GRCm39) N1666D possibly damaging Het
Cubn A G 2: 13,386,648 (GRCm39) I1539T possibly damaging Het
Dcdc2a A T 13: 25,304,372 (GRCm39) probably benign Het
Dgka C T 10: 128,565,463 (GRCm39) probably null Het
Ephb4 T G 5: 137,368,066 (GRCm39) V737G probably damaging Het
Etv2 T C 7: 30,334,167 (GRCm39) N189D probably benign Het
Exoc4 G T 6: 33,556,965 (GRCm39) C490F probably damaging Het
Gatad1 T C 5: 3,693,540 (GRCm39) R210G probably benign Het
Gpbp1l1 A G 4: 116,438,479 (GRCm39) M192V possibly damaging Het
Ireb2 A G 9: 54,789,671 (GRCm39) K115R probably benign Het
Mybpc1 T C 10: 88,396,223 (GRCm39) E208G possibly damaging Het
Nfic C A 10: 81,256,191 (GRCm39) A158S probably benign Het
Nos3 A T 5: 24,585,241 (GRCm39) I798L probably benign Het
Ntrk1 A T 3: 87,691,288 (GRCm39) L292Q probably damaging Het
Or52h7 G A 7: 104,214,183 (GRCm39) V252I probably benign Het
Or8u3-ps C T 2: 85,953,198 (GRCm39) T310I probably benign Het
Pcdhb2 G C 18: 37,429,416 (GRCm39) R463P probably benign Het
Pcdhgb6 A T 18: 37,875,526 (GRCm39) D78V possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Prelid3b C A 2: 174,311,155 (GRCm39) W59L probably benign Het
Prex2 T G 1: 11,182,967 (GRCm39) S405R probably damaging Het
Rp1 G A 1: 4,422,217 (GRCm39) Q248* probably null Het
Rspo4 T A 2: 151,709,735 (GRCm39) C47S probably damaging Het
Ryr3 C A 2: 112,596,656 (GRCm39) M2499I probably damaging Het
Smarca5 A G 8: 81,431,380 (GRCm39) Y946H probably damaging Het
Spata31d1e A G 13: 59,890,521 (GRCm39) I433T probably benign Het
Tcn2 T C 11: 3,867,649 (GRCm39) *431W probably null Het
Tert A G 13: 73,776,107 (GRCm39) E286G probably benign Het
Tnni3 A G 7: 4,521,416 (GRCm39) I196T possibly damaging Het
Unc79 T C 12: 102,964,699 (GRCm39) I49T possibly damaging Het
Zfp687 A G 3: 94,916,688 (GRCm39) S813P possibly damaging Het
Znfx1 T A 2: 166,898,681 (GRCm39) H81L probably benign Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11,311,685 (GRCm39) missense probably benign 0.00
IGL00513:Adamts12 APN 15 11,257,047 (GRCm39) missense probably benign 0.28
IGL00579:Adamts12 APN 15 11,152,100 (GRCm39) missense probably benign 0.20
IGL00984:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL01307:Adamts12 APN 15 11,237,632 (GRCm39) missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11,071,939 (GRCm39) missense probably benign 0.30
IGL01353:Adamts12 APN 15 11,292,091 (GRCm39) splice site probably benign
IGL01373:Adamts12 APN 15 11,310,816 (GRCm39) missense probably benign 0.00
IGL01522:Adamts12 APN 15 11,065,245 (GRCm39) critical splice donor site probably null
IGL01589:Adamts12 APN 15 11,311,323 (GRCm39) missense probably benign 0.26
IGL01715:Adamts12 APN 15 11,258,182 (GRCm39) missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11,258,269 (GRCm39) missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11,345,680 (GRCm39) missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL02216:Adamts12 APN 15 11,241,571 (GRCm39) missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11,311,101 (GRCm39) missense probably benign 0.01
IGL02336:Adamts12 APN 15 11,311,331 (GRCm39) missense probably benign 0.02
IGL02445:Adamts12 APN 15 11,286,798 (GRCm39) missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11,263,422 (GRCm39) missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11,345,650 (GRCm39) missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11,292,168 (GRCm39) missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11,241,574 (GRCm39) missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11,286,896 (GRCm39) missense probably benign 0.33
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0122:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11,071,594 (GRCm39) missense probably benign 0.11
R0308:Adamts12 UTSW 15 11,311,646 (GRCm39) missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11,311,144 (GRCm39) missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11,255,769 (GRCm39) missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11,277,544 (GRCm39) critical splice donor site probably null
R1173:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1174:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1319:Adamts12 UTSW 15 11,286,877 (GRCm39) missense probably benign 0.02
R1344:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11,256,980 (GRCm39) splice site probably benign
R1396:Adamts12 UTSW 15 11,311,558 (GRCm39) missense probably benign 0.01
R1418:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11,263,447 (GRCm39) missense probably benign 0.42
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1599:Adamts12 UTSW 15 11,071,797 (GRCm39) missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11,152,143 (GRCm39) missense probably benign 0.00
R1748:Adamts12 UTSW 15 11,241,548 (GRCm39) missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11,071,606 (GRCm39) missense probably benign 0.06
R1870:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1871:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1872:Adamts12 UTSW 15 11,217,966 (GRCm39) nonsense probably null
R1931:Adamts12 UTSW 15 11,270,685 (GRCm39) missense probably benign 0.00
R2041:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11,065,174 (GRCm39) missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11,286,169 (GRCm39) missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11,071,840 (GRCm39) missense probably benign
R4666:Adamts12 UTSW 15 11,311,578 (GRCm39) missense probably benign 0.08
R4731:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11,285,987 (GRCm39) missense probably benign 0.03
R4877:Adamts12 UTSW 15 11,327,787 (GRCm39) missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11,259,108 (GRCm39) missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11,300,054 (GRCm39) missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11,285,962 (GRCm39) missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11,327,843 (GRCm39) missense probably benign 0.18
R5492:Adamts12 UTSW 15 11,336,384 (GRCm39) missense probably benign 0.05
R5580:Adamts12 UTSW 15 11,152,086 (GRCm39) missense probably benign 0.14
R5645:Adamts12 UTSW 15 11,277,506 (GRCm39) missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11,286,836 (GRCm39) missense probably benign 0.15
R6240:Adamts12 UTSW 15 11,286,044 (GRCm39) missense probably benign 0.44
R6331:Adamts12 UTSW 15 11,241,519 (GRCm39) missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11,257,080 (GRCm39) missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11,255,721 (GRCm39) missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11,215,759 (GRCm39) missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11,065,187 (GRCm39) missense probably benign 0.00
R6821:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.14
R6913:Adamts12 UTSW 15 11,215,778 (GRCm39) missense probably damaging 1.00
R7188:Adamts12 UTSW 15 11,336,411 (GRCm39) nonsense probably null
R7290:Adamts12 UTSW 15 11,277,452 (GRCm39) missense probably benign 0.08
R7307:Adamts12 UTSW 15 11,217,899 (GRCm39) missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11,277,425 (GRCm39) missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11,317,365 (GRCm39) missense probably benign 0.00
R7484:Adamts12 UTSW 15 11,345,734 (GRCm39) missense probably benign 0.25
R7562:Adamts12 UTSW 15 11,270,697 (GRCm39) missense probably benign 0.01
R7653:Adamts12 UTSW 15 11,257,115 (GRCm39) missense probably benign 0.28
R7696:Adamts12 UTSW 15 11,258,224 (GRCm39) missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11,317,298 (GRCm39) missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11,263,423 (GRCm39) missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11,310,904 (GRCm39) missense probably benign
R8032:Adamts12 UTSW 15 11,259,189 (GRCm39) critical splice donor site probably null
R8109:Adamts12 UTSW 15 11,331,877 (GRCm39) missense probably benign 0.02
R8402:Adamts12 UTSW 15 11,263,376 (GRCm39) missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11,215,813 (GRCm39) missense probably damaging 1.00
R8782:Adamts12 UTSW 15 11,237,678 (GRCm39) missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11,300,015 (GRCm39) missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11,286,065 (GRCm39) missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11,317,443 (GRCm39) critical splice donor site probably null
R9042:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.08
R9162:Adamts12 UTSW 15 11,311,721 (GRCm39) missense probably benign 0.29
R9190:Adamts12 UTSW 15 11,336,446 (GRCm39) missense probably benign 0.02
R9700:Adamts12 UTSW 15 11,311,442 (GRCm39) missense probably benign 0.04
R9748:Adamts12 UTSW 15 11,310,628 (GRCm39) missense probably damaging 0.99
V1662:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
X0022:Adamts12 UTSW 15 11,277,534 (GRCm39) missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,317,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAAGATACTCCAGGTTCTC -3'
(R):5'- CAGAATGACATGCCTATCCCTG -3'

Sequencing Primer
(F):5'- CCAGGTTCTCATACCAATATTAAGG -3'
(R):5'- GACATGCCTATCCCTGGACCC -3'
Posted On 2019-05-13